Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL16B
Systematic Name YNL069C
Alias L13, L16B, L21B, RP23, uL13, YL15
Strain S288c
Description N-terminally acetylated protein component of the large (60S) ribosomal subunit, binds to 5.8 S rRNA; has similarity to Rpl16Ap, E. coli L13 and rat L13a ribosomal proteins; transcriptionally regulated by Rap1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL16B YNL069C
TAAATCGCAGAATGTCAAAAGTTCTCCAGGTGTATGGAATTTATTGCAGTTTAGCTCAAC
AAACAACACTCCTGCCGCAGATAGCGGAGGCAACAAGAGAGGATTTTCCATAAATCCGGA
CATTAAAGCCAAAGAAAACGAGAATGCTACTTCAGAAAAAGATTCGGACTCTAACTCAAA
TGATCTGGAAACTAAAGATATTAATTCTTCACCTTTGAAAAACCAAGGTGGTAGCACCGC
CAATGCCAAGGAACTAATACTAGATACGGATGGTGCAAAGATCAGTATTATCAACAACTA
AGACAAGAAACAAGGTGAATCACTAAGACTAAAGAAATGAATGAGAAATGGCTAAGCTGC
AGCCAGTCATATGAGCTGCTTTCCTTTCATTCTATTGTCGTCCGAATCTATGTCACGAAG
TACATATATAACTGTCTTTCATATATAATATTTAATCACCGTGCATTCCCTATTTTACTC
TTCCTCATGCGTTTGATCATCTGACCTTTATGATTTTGAACACCCCGCAATGTTCACTCT
AATTTATGCAACTGAACTTTATTTTCGCTGCTGTGTTTGCATCCTTGACATATTCAATCC
GTACACTATACACACCCAAACCTCCTTTAAAAATTTCCTATGAATCAGAAAATTTGGCTG
TTTCTCAACGCTTCGGCCAACGGGTGAAAAACAGCGGCAGAAGGACTTCCTTCGGAGAAC
GCTCCTAGAACCTGAAACTGCCCGCTAAAGCGTCTCCTGGGCTGTCCCCAAGTGGGTGAT
TTTCCATTTGATCCTTGTATCAGCTTGGGAGGGTGGTGATCTCTTCTTAGGCAGACACTT
GGTCCCTCCGGCTAAACATTCGCACTGCGGACCGCTGCAATTTCGAATTCTGGAAAATTA
TTCTGATATTGGTAAAACTGATTCTTAAAACTATAACACATGTAGATATTCCACTAAGTG
CATTTTGTTAAGGTATTAAACAACCAACCAACCATAAAAG
Chr coordinates Chr XIV from 494524-493956,495001-494974
w3c xhtml validator w3c css validator