Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YNL092W
Systematic Name YNL092W
Strain S288c
Description S-adenosylmethionine-dependent protein methyltransferase; capable of automethylation; member of the seven beta-strand family; YNL092W is not an essential gene
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YNL092W YNL092W
GATAAACATACAGCAGCTATTCCAACATTAACTATCAAAGTAGTCTTACTCGGAGAATCT
GCTGTCGGGAAGTCCTCAATAGTCCTCAGGTTTGTATCTGACGATTTTAAAGAGAGCAAA
GAACCTACTATTGGTGCCGCATTTTTAACAAAGAGAATTACAAGGGATGGCAAGGTCATT
AAATTTGAAATATGGGATACGGCAGGCCAGGAGAGATTTGCTCCTTTAGCGCCTATGTAC
TACAGAAATGCTCAAGCTGCTTTGGTAGTTTTTGATGTTACTAATGAAGGGTCTTTTTAT
AAGGCTCAAAACTGGGTCGAAGAACTACACGAGAAGGTAGGACATGATATCGTTATTGCC
TTGGTGGGGAACAAAATGGATTTGCTGAATAATGATGACGAGAATGAAAATAGGGCTATG
AAAGCACCAGCTGTACAAAATCTCTGTGAAAGAGAGAACCTCTTATATTTCGAAGCAAGC
GCTAAGACTGGTGAGAATATTTACCAGATATTTCAAACATTAGGCGAAAAAGTACCATGT
CCTGAACAAAATACACGACAAAGCTCTACTCATGATCGCACAATTACCGATAATCAACGA
ATCGATCTCGAATCAACGACTGTAGAAAGTACTAGGGAGACTGGGGGTTGTAACTGCTAA
ACTGCAAGCAAAACAACAGCAAACGCGGCATATTCAGCGTCTTAGCGAAGCTTGCCATTG
AAAAGAACAGTTCGTAACAACAGCTGGAAGAATAGTACTGGAAATTTTCAATTACTTTTG
CAAAACAAGCACTTTTTTGTTTCACTTCCATTAGCCGCAAGAAATACACTTTTTTTAGGG
GCGGGAATTTTCATCGCCAGATCGAGAATCACAAGGCCTTTACGTACTATAGTTTGTAAT
TTATACAAAATCAGCTACTGTTATTTTGGTGTACCAGCGGCAAAAATTGGTGAGGATCTG
AAAATTAATTAGAGGTGAACACATATCAGTAATTTTGACT
Chr coordinates Chr XIV from 450871-452073
w3c xhtml validator w3c css validator