Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MDG1
Systematic Name YNL173C
Strain S288c
Description Plasma membrane protein involved in G-protein mediated pheromone signaling pathway; overproduction suppresses bem1 mutations
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MDG1 YNL173C
AAATCGTAGCCACCATCCATGAAGGACGCTGAAGTCTCTCTCTCTAAAATTACTCCATTT
GCATACCAGAATGCATTACCTATCTGGAATGGGAAACATACAGTCGTAGAACCCCCATTT
TTCAACATATATACATGCGCAATATCAGAGAGAACTACCACAAAACAATCTGGTGTCTTT
TCAAAATCAATGTACCCAGCTTTGATGATCTTTTGATTATAAGTAAACTGACGTAAGCAC
TGGTCTTCAATACACCATTTAACACTCCTTCCGTCCCTTGACAACCAAATATCTCCATTT
ATACCACCTATTTTGTTTGTGATATTAATCTGCAACTGCCATTCGGGAGAATCACCAGTA
TATTCGCCATTGTGAGTTTCCCTTGGTAAATAATCATTTCTAGTAGACGGCTTAGAAGTC
ATAAGTTATAACGCTAGAAACTAAAGAAAGGAAAAACAGATTAAAACGCTGCTATAACAC
ACTGATTATCGATAAGCAATATTCTAGCTCACTTTGTCACCGTGAATTTGTCAGCAAGCA
CCAAAAATGTCGATGCTTTCAATGACTATTACGTATCTTCTCTACTTTTGTGCAAATGTA
AATACTAAATGAAAGCCCTATTTTGTGTAGGGTTTACACCGCACAAAGTAAAAAGAAGCG
ATAAAAATGAAAAAAAGTAGTCAAAATACATACTATCAAAGTAAGGGCATTGGTGAAATA
CTGCGAGGCTGGCCTTTTCCGCAAATATCTGGGGCAGCGAAGCGAAGGGGCCCGATAGGA
ACTTTTGGGGCGGGAGCCCTTGCATTGACATGGTTAAGGTTTTACATCCATCATTCTCCC
CCTCTCTTGTGGTTTAAAAAAATAAAAGGTGGCCGATTTTTATGTAATATAGAAACGACT
TCTGTCCTTCTGTCCTCTGTATTACCTAATTTTCTTTCTCTTGATGGTATTTAACTTTCT
AAGCATTATAAGATAATATTAAAGGGAAAGTGTTTCTAGA
Chr coordinates Chr XIV from 310057-308957
w3c xhtml validator w3c css validator