Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name URE2
Systematic Name YNL229C
Alias [URE3]
Strain S288c
Description Nitrogen catabolite repression transcriptional regulator; inhibits GLN3 transcription in good nitrogen source; role in sequestering Gln3p and Gat1p to the cytoplasm; has glutathione peroxidase activity and can mutate to acquire GST activity; self-assembly under limited nitrogen conditions creates [URE3] prion and releases catabolite repression
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>URE2 YNL229C
GCTGAACTCGCTGAAATTGAAAGAAAACTGGCAGAATCGTCTTCTGAAGACGAAAGTGAA
GATGACAATCTCAACATAGAAATGGATATAGAGGTAGAAGACGTCAGTTCGGATGAAAAT
GTACATGTGAATACGAAGAATAAAAAGAAAAGAAAAAAGAAAAAAAAAGCAAAGGTTGAC
ACAGAAACAGAGGAATCTGAATCGTTCGATGATACTAAAGACAAACGGAGTAATGAGTTG
GATGATCTTTTGGCATCACTAGGAGACAAGGGCTTACAAACGGATGACGATGAAGATTGG
TCTACTAAAGCGAAAAAGAAAAAGGGCAAACAACCTAAAAAGAATTCTAAATCCACAAAA
AGCACTCCGTCCTTGTCGACTCTACCGTCCTCTATGTCTCCAACCTCCGCGATCGAGGTG
TGCACTACATGCGGAGAATCATTTGATAGTCGAAATAAGCTATTCAACCACGTGAAGATA
GCAGGGCATGCGGCAGTGAAAAACGTAGTGAAAAGAAAGAAAGTCAAGACCAAAAGAATA
TAGTGACACCAAACCATAGAACGCCGAAACAGAAATTATTAGTAGAGCTGTGTAGAGTTT
AATTTAACTGTAGTCAATGTGGAAAATGAATACCGACTGTTGTCTGGAATAACAACATTA
ATCCGGGTGACGCAGCCTGGAATTTTTTTTTCAATTCTCGCCGAATAGGAGGATTGATGA
GCTGCCACTATTGAATTTTTGAGGAAGAGTGGCTTCAGCATGTAGTTTTCCTTTCTACTA
GGCCAGAAAAGCAACTATACAAAGACGAAAGCTTCCTTACTCGAGGTTGAAAAGAATAGC
AAAAATCTTTCCTTTTCAAACAGCTCATTTGGAATTGTTTATAGCACTGAATTGAATCGA
AGAGGAATAAAGATCCCCCGTACGAACTTCTTTATTTTTAGTTTTTCATTTTTTGTTATT
AGTCATATTGTTTTAAGCTGCAAATTAAGTTGTACACCAA
Chr coordinates Chr XIV from 220201-219137
w3c xhtml validator w3c css validator