Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YNL234W
Systematic Name YNL234W
Strain S288c
Description Protein of unknown function with similarity to globins; has a functional heme-binding domain; mutant has aneuploidy tolerance; transcription induced by stress conditions; may be involved in glucose signaling or metabolism; regulated by Rgt1
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YNL234W YNL234W
AATTTTAAACGAGTCATCAACTTTTTTGAAACTAGTCTTATCTGAATCACCAGTGGATTT
CGAAAAATTTGAAACGTTTTTAGTTGATGTAAACAACAAATTTATCGCGCTATGCGAACA
ACAGCCATCACAGGAACGTGAGTTTTCGTTGTTGGTGAAAGCTGAAATCCCCCCAGAATA
TGCCAAAGTGGGAGATTTCCTCCTGCAGTATGCTAATAATGCAGTGATTTCCCATGCGAA
TGCGGCTGCAGTATATTTTGCAGATACAAGTGGCTTGAAAATATCTAATTCAGAGTTTTT
CAATCCCGAAATATTTCATTTATTGCAACCATTAGAAGAGGGATTAATTATTGATACAGA
TAAACTACCCATAAAAAATAGAACCTCCAAATCTTTTAGCAAATTACTGTACGACGATGT
AACCTGTGACAAACTGAGTGTATCAGAAATATCCGATGGGAAACTTAAGAGATGCAGTAG
GTGCGGTTCCGTCACAAGAGCAGGAAATATAATATCGAGTGATAAGACAATTGTACCCAC
TAGCATCCAAACCAAAAGATGGCCAACCATGTATACAAGACTGTGCATATGTTCAGGTAT
GCTTTTTGAGATGGACGGCTGATTATTAGTACTATAGCATAGTTTTGTATAGAATTGTTT
TAAACATTTCACTTCTCGACTTAATAAAAAGAAATGAGAGTGACAGTGTCTGGAATTTCT
TTCTTCTAGAATACCAAGGGTACGCATTTCTCTCCTACGGAATTTTCTGTGCAGATGTCC
CGATCTACGTGGCAGATAGTGAAAACTCCGTAGGCAAAAGGGGCATCGGAAAAACCTCTT
CAAAAAAAAAGGTTTTTAGGCTCGAACGAGCCGGAGCAATAATGTTCCTTTGAAAAATAG
CAATCGTTATGCAACCATTTTATATGAGTCTGCCCCTCAAGGGACTCGCCACCGGACCGC
TGCAGTTGTTTGCATTCATCCACATATAAGCTGGTTGTGT
Chr coordinates Chr XIV from 210233-211513
w3c xhtml validator w3c css validator