Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FOL1
Systematic Name YNL256W
Strain S288c
Description Multifunctional enzyme of the folic acid biosynthesis pathway, has dihydropteroate synthetase, dihydro-6-hydroxymethylpterin pyrophosphokinase, and dihydroneopterin aldolase activities
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FOL1 YNL256W
ATTTTCCTTCCAGAATCTTTCGTTATAAAAATGCTTCTTGACTTTAATACTTTCATTGAC
TCTAGTATGAATTTATCTAAGCTTAATTTTACTGCTGATATGGCACTTATGAGGTCTAGG
GAGGCCTTAAGGTAGTTTTTTTGCACTTCAAATAATTGTAAGGCATCACTTTTGATAGAA
GATGGCTCTAAACTGGTTTTTGAAATTCTTATAGCCTGGTAGGATGCCAGCATACTGTCA
TATTTACCTTGGTAAAAATCGAAATTTTTTCTCACGTTTCTGTAGGGTTCAATTGCAGTA
GTCATAAGTTCTAATAGCGCGGTTGAGTGGCTAGAGTCATCACCCTTTACAATTTGCAGT
AATTTCATAGAAAAGTCATAATAGTCCTTGTTAAAACTATCAATCAGCCTGGGAGTAAAC
GATTGGTTACTGACAAAACCGTTGCTCAGCAAGGCTGGAGGAGGTAACAATTGGGATAGG
AGAGTTTCCTTTGCTCTTCGAAAATCTTCAAATGACACCTTATATTTCTGATCGAAAAAG
TCGACAGTCTTCTCTATCCAATCCTCTAATGCATCCACCCTTGTTTGGAAGAAATTTACG
GATGCACGAAAGGAAGGAGAGTCAATTGATGCTTCTTTGAATGCAACCGATATTAGCCTT
AACTGCCTCTTTTTGGGATCCCTCCCGTGAACGGACATATTTCAAGTAATGATATATCTC
TGCAATATGTCAATTGATCAACAGGTCTACTCATGCAGCTATGTTTTAGTTACACCTAGT
AGTTTAAAATTTCACGTGTACTTTCCCTGTTTTGAACGCATTAGCAATAGCGCTGGTGTC
GTTGCGCAAATTCATAATAAAAGGAAAATTTGAAAAACTTATGATAAATTGCAAGGTCAT
CGAAAACAGAAGAACAAGGTTTTTTCCTTTAGTAAATGCAAAATTAGTAAAAGTGATAGC
GTCTTCTTTGATTAACAAGTTTCAATCTTTGCCTTTGGCT
Chr coordinates Chr XIV from 164623-167097
w3c xhtml validator w3c css validator