Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BIO4
Systematic Name YNR057C
Strain S288c
Description Dethiobiotin synthetase; catalyzes the third step in the biotin biosynthesis pathway; BIO4 is in a cluster of 3 genes (BIO3, BIO4, and BIO5) that mediate biotin synthesis; BIO3 and BIO4 were acquired by horizontal gene transfer (HGT) from bacteria; expression appears to be repressed at low iron levels
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BIO4 YNR057C
CATAGTTTCTGAACTTCGATTAAGAACTGTGGATGGTATGGTCGCAAACCTCCTGCACCC
TGTAAGATAGGCTCCAAAATCACAGCACAGATCTTATCACTATGCAATTCAAATTGCTTC
TTGAGATCGGTAACTTCTTCTGCATTCCAATGGTCCTCGAAACCGTTCTGGCTGGTTGGA
AGGCCATCGACAATAGAGGGAGCTTGGGCGAAGATGTTCTCACTGAGTCGATCGTTGTAG
ATATGATGCATAGAATTCTCAGGATCACAAACACTCATAGCGCCAAATGTATCACCATGA
TACCCGTTCTTGATTGTCAAAAACTTTGTTCTATTTTTAGTAGCTTCCCCTGACATGTTT
GATTGTAAAGCCATCTTCAAAGCTACTTCCACTGCTACTGAGCCAGAATCTGCGAGGAAA
CAGTACTGCAAAGAGGGTTCATCAATCACTTTTAAAAGTTTTTGGACTAGATTCACAGCT
CCTTTATGGGTGAATCCACCAAGAAGGACGTGAGAAAACTTTAACATCTGCTTGGTAAGG
GCCTCATTTAGTTCTGGATTATTGTACCCGTGAATAACACACCACCACGACGACATGGCG
TCGATCACCTCGACGTCCACTGGTGAGTCGGTATCCAACACCAGCTTGCATCCGTGAGCA
CTCTTTACCGGATAAACGTTCAATGGTGAACTCAATGACGTATAAGGATGCCAAATATGT
TTTTTATCAAAGTCTAGCAGTTCCGCGACATCTGGTGTATATGAAATTTCTTGGGACATT
AGTTGTTATCCTAGCAATAGAAAACGAATTGCGCTGTTGACATCCTCCCGACCAAAAGAA
AATGAAATATACAAACAATGGCTATTTATAATTCAAAATTATTGGGCAAAACAAAATAAA
ATCCCGCTGGTAGTTCGTTTACTGAAGTATATAAAGAGATATACTTTTTTCCACAAGTAG
GCCAGTGAAAAGAACTCAAAAAATCACTAGCGCACAGGTC
Chr coordinates Chr XIV from 734069-733356
w3c xhtml validator w3c css validator