Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IFM1
Systematic Name YOL023W
Strain S288c
Description Mitochondrial translation initiation factor 2
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IFM1 YOL023W
AACTAAATATACATAGCACCCTCACACAGGATGTCAAAACTATCGTCTTATCCTCATGCC
GCCGATTTTATAAATATGGAAGAACCGCCAAAATCTAAAGAGTTTTTCGATGATCTTTGT
GCCGTCCCTAATTTACTCAAAAGACGTTTTCCAAACTCTCGAAGATCGACGCATTATTGT
GAGGCTTTAAATTATTCTAGGAAAAAGCTTCCTGTTGTGTTGTCTAAAATGACACTGCAA
GAGTTGAGGCACAATATGTCAACATTTTTTTTGCAGGAAAAGGATCAAATAAATATTTAT
GACACCTGTAAGGTGATAGACATGGGGGACCGTGTCTTGCTCGAAACTATGCCTCCACAG
CCAAGAGATTTATTTGAAAAATTGCATGCAAGTAAAACAAATTTAGTAGTTCAGACAGCA
GCTTTGGATGAACCCCTACTTACAGTAAAAGCAGAGCTACAGTCATCTTCCTTTCCACAA
AAATCAAGCCTATTTCTGTATGAGGATTATAAAAAATTTATTTATCAACAACTAGATATG
TTTAGTTAATTACTTACGAAAAGAGAGGCTATTGTTTATTGTTGGCCATTTTATTTATTA
TTATTTTTTTCCACCTTAGCATAAGGAAACACGATTTGGATTTCAAAAGTAGAGCTTTAA
TAACAAAAGATAAACAACCACAGTGTCAAGAACGGTTACAACGAGAAGGATAGGCTGATG
ATTTATCAAACATCTTCTTATTGGTTCCTAGTAATTTCCCTATTTTTGAGCAACAAAATG
TCGGGATAATATTCTCATAATACTCAAACACTCTTAATATCATATATATATATATACAGT
CATTTTTTGTTATTCGTTACCCGAACTTCTTTATTATTATAACCAGGGAACATCAATAAC
GAGCTACAATAATCATGTTCATCTCCCTCATTGTCTCTTATTTGATGTTACACACGCTTT
TCTAGCATAGGAGGAACTTCCATATGCATACTAATAGATC
Chr coordinates Chr XV from 278056-280086
w3c xhtml validator w3c css validator