Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SIL1
Systematic Name YOL031C
Alias SLS1
Strain S288c
Description Nucleotide exchange factor for the endoplasmic reticulum (ER) lumenal Hsp70 chaperone Kar2p, required for protein translocation into the ER; homolog of Yarrowia lipolytica SLS1; GrpE-like protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SIL1 YOL031C
CATCCAGGATCAAGTATATACCGTTCTCCTGCAATAGTTTCATACAATGGGAATGATCTT
GCGAGTTATCCACAGTATAAACTCTGACAGTATTTATCCCTAGATCTTTCAGAACGGGGA
CGTCTCTGTCACAGACAGATGCGTCTGCTAAGGGATCAGTCAAGTTAGAAGAACCACCAG
GCTGGTAATCAACACCACGGATATAAAACCTTTCACCTGATTCCGAATTAAAAAATGCAT
TGCCTTTAATTTCAATGGATGGTGTGGAACTGTTACTGCTGCTAGCAGCCTGAGCCAAAC
CAGCACTTAAAACGAAGGCACTTGTAAGAGAACGTAGTAACATAGCTATTTAGAGCTGTG
TGTGTAGCGAGTGATATATAATATGTTTGTTACAGCCCACTGTTTACTTTTATATACGAA
ATGCAACACTGTCAACAAATCAGTTCAGGGACCTTCCTATTTATAGTATAAGCAAAATAA
AAGTGAAAAATTTCCTGCGGAGTTTTTTTTCTCGAGAAATTGTGAACAAAAGAAAGCAAA
GACACAGAAGATGATAAGAGAGAGAAACAACGAAGAAAGAACAACAATGTTGGGGTTCAC
CCGAGAGATATTGACATACTGACCTTAGAAAAGGCATTACTGAGGCTACTGACTAAAGCG
CGTTACATAAATGCATAGTATATTTCTTGTTGTATACGCAGCGGCCAACTAGTGGCAGCA
AGAATGTAATGAACGATTCATCTGCAGGTTTGGAGGCCGCAACTAGATCAAAACGTAAAT
AGCGGGTGAAGTGTTCTGGACGTTAGAAGTAACGTCCGCAGATCGAAGCTAAACACGAGA
TTAGATTTCGGGTAACGGAATTGTGATAATTAAGAAAGACCAGACTATGTGAAAAGGCCA
CGTAAATGATAGAGCACACATTAGCAACTATAATAGACTAGTTTTCGCATCGCTGGAAGT
TCTCGATATTGAATATCACTTCCAAGAACGCAAACTTAGA
Chr coordinates Chr XV from 267529-266264
w3c xhtml validator w3c css validator