Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RIB4
Systematic Name YOL143C
Strain S288c
Description Lumazine synthase (6,7-dimethyl-8-ribityllumazine synthase, also known as DMRL synthase); catalyzes synthesis of immediate precursor to riboflavin
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RIB4 YOL143C
TGGTATGTGCAGCCAACACTTTTAATAACGGGAAGTCATTATTGAAAAGCAACTGGCGTG
CGAAATTCAAATTCACGTCAATGATCATACCATCTTCCAATATCCCGAAACCAGCATCGC
GTCCTGTAGTTGAGTCAAAACATTCTATTTCGGCTTCTAGTTCCTTTTCTGCGGTACAAA
CTCTCGCATACACTAGATCTCCCACTTGCAAAGTTGGCCTGTTTTTCTTTGAAGCATTGG
GAAAAGCCATATACGATAGTGAAACACTGGAGGAGAAATTTTGCAACGAAACCTTATAGC
TATCTGAAAATGTCCCTATAATGACACCGATTACAAAATCGTTTACAGATGGAATGTATC
TCTTACTAGAATAGTCTATATATGCGGTCTGAACACCACTCTTACCCTTAGCGGAAACAT
GCAAAACACCTGTATTAACAGGTCGTATTTCTTGAGTATTGGGGTCACAATATATGCCAG
GGCCCAGTTTAACAGGTGTAGTAGGGTCTACAGGAAAGCTATCACCAGGGAATATGAACG
TAGACATCTTGTATGCTCTTGGTTAGTCGAAATGCTGGAGATGAGCTGCTGAAGCATCCG
TTTGTGCTGTTGGTTTAATATGCTTCTCTAAACCAAAAAATTTCAGCCGATCAGGTCCGG
GTCACACCACTACCCTTACTAGTAAACAATGATGGCTTTCATTAAGGTAACTTTAAGTGA
GGTGGATGGAACTAGTTTCCACGAAACTTCATCGAAGAGGTCTGGGGTTCTATGACGTAT
AATTAAAACTCTGGGAGGTTTTCGGAGGTTCCCGTAGGTCAATTCTTAAGGCTCTATGAC
ATATTCTGGGAGCGGAGATATTTTCGGAGGTCCCCGTTAATAAGAGAAAAGTAGCCATAT
AAAAGAGAACAATGAAATATTGCCCCAGAGAGTGGGTTCAAAAGCATGAAAAGGAACAGT
ATAACGCAGTATAACGCAGTATAACGCAGTATAACGCAGT
Chr coordinates Chr XV from 55104-54595
w3c xhtml validator w3c css validator