Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TIR2
Systematic Name YOR010C
Alias SRP2
Strain S288c
Description Putative cell wall mannoprotein of the Srp1p/Tip1p family of serine-alanine-rich proteins; transcription is induced by cold shock and anaerobiosis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TIR2 YOR010C
AAACTTAAAACAATCCATTACCTGCCTAGTATAATTTTTTTAGACCAGAATATGACTCCA
TAAAACGTGAAGCAGCAGCTAGAAAAACGACGCCTCGGCGGAGTTTGCGTTTAACTCTCA
TGTGCGGCCAAACAGGTGCGTAAGAGCTGTGACTATTTAATTATGTAATATTTACGGAAA
AAGGAGTGGACAAAAAAGGCGTGAATTTTACTCCACTGGCGGTAGCCGCCTATAAAGAAA
TTGATAAGAGGCGTGCCTCTTATGCGATCTTCGGACCAACAACAAAGCACACAATAGCGC
AAAGTATACACAATAGAGAGCCTGTAGGAAAGCAGTGGGGAATGTCTTGGCTTTTTTTAT
GCCCAGAAAAAAATAAACGTAACGTTGGGGAACTACGCGCAATCATATTTCATGGCCTCC
CCACGGTGCTTAGAGCAGCGCGTTGCCTACAGAAACATCTTTATAAAATCTTGGCCGGCC
AAGATTCCCAAACGAGACTCACATTTCCCAAAAAAGACATTTCTGTCCAAAAGTAGAAGG
CAAGAAAACCCTGGAGGAATCATAGGCAAAGAAAGAAAAGAAGAAGTTCATCTTTAAAAC
TACCTTTCAAGCCTTTATTCGTTCCTCGTAAAGGACACACGAAAAAAATAAACAGTACCT
TGCAGAAGGAGTGCAGAGTTAGGTCGCAGGGAATCCTTGAAAGCCAAGAGTTTTTTTTCC
GTAATGATCTCCCAAAGCAACCATCAACATTGTGGTGCAAAGTTTAGTGTAAGATGTTCT
ACTGAACTATCTTAATAGCTGAGCATCATGTGAGTAAACGAGTAAGCAAGAAAACAACAA
AGTAATGTTCAACTTTCGTAACTACGGAAAATAATATATAAGTAGTTAACGAAATTCGAA
CAATGAGAGCTCTCACATATCATCTTCTTTTCCAGTTTAGCCATTATCAGCACAATAATA
CAAAACACACTCGTACACTCGCTTCAACTATAACAAAAAA
Chr coordinates Chr XV from 346950-346195
w3c xhtml validator w3c css validator