Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PET127
Systematic Name YOR017W
Strain S288c
Description Protein with a role in 5'-end processing of mitochondrial RNAs, located in the mitochondrial membrane
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PET127 YOR017W
TTCCCCTTAGCACAGCTGATCCAACAATTTTAAGAGCTTGAAAAGCAACCTATACGTAGT
TTTTTTGGCGACTGGTAAAAAAGAACTGAATAATTAATGCCTGCACTATACTGATACCAA
CCATTACCCCCATAATTAGTAATGAGAGCCATGTTAATCTTGACTCAGTAGAACTCACAG
TATACATGTTTCTCCATTCTCTAGCCCTTAAATAATCCATTGTTTTGGTGATCTTATTCA
GGTTCCTATCAATTTCCTCGATGGCGTTGTTTGCGATTATGTCCTCTTTGCTTTCATGGG
AAGAAACAATTTCCTTTTCCTTTTCGAGGGTGATTTCAACTTTCTTTGGGGAAGTGCCGT
AGTTATTACTCAAACAGAAAGTGTACTTACCTATACCAAACGACTTCAGTAGAAAATCAG
AATGCTTCTTTTGTCTTTCAGTGACGATAACAGAGCCATCAGGGGCGGTAATATCGAAGT
CTATCTCGAAATTCCCACCTGTCAAAACTTGGTAACTGACCACAAGGACATCTTTATCAG
AGGATAAATCATAGTAAAGACATTCTTTGGTAAAAGCAGGTAATGATATGCCTACAGGAG
CATAATTAGAGGAGAATGCATGTGTTAACAAAGATGAACTAAACAAAATCGCAATCAAAG
TAAAAACGCGCATAATTCCTAGCGATGATTGGGAATATATATTTATGAAAAAACTTCACT
AGCGCTCGTGAAACTACTTCAAAGGCAGCTGGGAAATAAATGTCTTCAAAGCAGAGAAGA
GTTCCCAAATAGAATTCTCAGATCGTCAATCGCTCATCTTTGAGTATATCACGTCAAAAA
ACAGGAAACAGTGAAAAAAAAGTAGTCCATAATAAAGCGCGTTTCCGTCAATGCCGTTGG
TTAATAAAGAAACAAATATGTAAAAATATAATATAAACAGGGCACTTGAGAGAGCACAAA
AAAGAGCCAAACGCTACCTGATACTTTTATAGTTTTGATA
Chr coordinates Chr XV from 361412-363814
w3c xhtml validator w3c css validator