Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ETT1
Systematic Name YOR051C
Alias NRO1, YOR29-02
Strain S288c
Description Nuclear protein that inhibits replication of Brome mosaic virus in S. cerevisiae, which is a model system for studying replication of positive-strand RNA viruses in their natural hosts; deletion increases stop codon readthrough
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ETT1 YOR051C
GGGTGCTATACCGTTGAATTCAAGGTCTTCTAGTAACTCTAGCGTGACATCGACGGGTCA
GAGCAGTAGGCGGGTGACTAAGAAAACGACCAAGAAGAAAAAGAAGAATGCTTGTTATTT
CGATACCTGTTCAAGTGCGGCTTCGAAATTCATCGGTGACTGTAATTTTTGCAAAGGTCA
CTTTTGCTCGAAACACAGATTAATGGAAAACCATGCTTGTAATGGCTTAACGAGCTGCAA
AGAACAGCTACATCAAAGAAACGCTGATAAGCTAGAAGCTGAACAAACTAAGGCTCCAAA
GATACAAATTTAAACACCTATCATGGTTAAATCATACACACATCTAATTCACTGGGAACT
GCATTGTAACGTCTAATCGGCATTGATGTTACACAAGGGAAAAGAACGCTTTTGATGCAT
TTCTCTACAAAATAACATGTATAAATTACTTGAATGGTCTCTTCGTTTTTTTTTTTTTTT
TCTTCATCTATCCTGACTCATCAAGAGAGACCGTTCATTGTAACCACTTACTCTTATATA
ACGTATAACTAATAATATTAATAATCAAGAAGTGGTGCTTAACCTTTGAAACGCCTTACG
CAAGAACCTAATCTGTTGGTTGGTCTTTGGTTTTTCGTTTCTTTTTTTGTACGGGGAAGA
AAGGGAGAAAACGACTTTTTTTTTATGTTTACAATTCATTTTTAAGCGTTAAGGCAATCG
AAATATAAACAAATGAAAGCTGGAGTAACTTCACCATTTCTTTTTCCATTTCATGAGGTT
GTAGCGGAAAAACAATTTTCCGCATATATCGTTTTGCGACCGAAAGAGGTAAAAAAAAAA
GTGCGAGAAAAAGAACTCTTTTTTTCGTCATTTGAAATGTTGCATATTTTGAAAAATTTC
AATATAAACTAGTTTTTAAATAATAGAACAATTGTAGGCACCCAAAAGAAAAAGAATTGA
AGAAAAAAGGAGAACAGTCCAAGAAAGTAATCGTACAGAA
Chr coordinates Chr XV from 426084-424846
w3c xhtml validator w3c css validator