Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MCA1
Systematic Name YOR197W
Alias YCA1, [MCA]
Strain S288c
Description Putative cysteine protease similar to mammalian caspases; involved in regulation of apoptosis upon H2O2 treatment; contributes to clearance of insoluble protein aggregates during normal growth; may be involved in cell cycle progression
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MCA1 YOR197W
GTATTTGGTGCCTTCTGTTTGATTTTGCGAACCGTCTCGGCCAGGTGATTAGCACCACCA
TCGACTAAATCGTCCCTATCAACGGTAGTTAAAACAACATAACCCAACCCCCATCTTTTG
ATAGCTTCGGCAGTATTTTCGGGCTCCATTGGGTCCGGCTTACTAGGCGTTCTATTGGTC
TTCACAGAACAAAACCTACATCCACGAGTGCAAGTATCACCAAGCAGCATAATTGTTGCC
GTTGCCTTAGATTTATCTTTGCCTCCCCAACATTCACCAATATTGGGACATCTTGCCTCC
TCACAAACAGTACTCAGGCCTAATTCTTTTACGTCGCCTTTCAATTTATGGTAATTGGTA
CCCTTAGGAATAGGAACCTTAAGCCAACGAGGTAGTTTTTTAGCTTCCTCTGTATTTTGC
CTTGCCTTCTCCAGAGGGTCCAAGATCATTTTCGAAGCTTTACCTGAAACAAAATCTGCA
AAAGATGGACCCAAATTAAGAGCATCTTTGAACTCTGTAATTCTTTTTCTGTTCCCCTTG
CGTCTTTTTCCCGAAGTCCCTGTTAACTGACTGGTTGCATTTTCAACCTCAGTTGAATTT
CCAACTGGTACCCTAACGCTAGCGTTATCTGAATCAGTATTCAATGCATTGGATCTTATT
GGCCGAGTTGCGCTCGTTCCACACCTAATAGTGGACGAAATCCATCTTGTATTTCTCCCA
ACAAATAGTACTCCAACAGATCGTCTATACATTATTGTGGCTTAACAGTTCTCCTTAAAA
TCCACATAACTGACAAAACTGGATACTTAATGCCCATCGAGTCATATACATATATTTGAT
TACTACAAGTGCTTTTCAAATAACTGCTTCGAGAAAAGCGTCCGGGTAATAACAACTATT
GAAAAAGCATGGCTTCGCATTAATAGGAGCCAAAAATATGAAGATGAGCCTCGAAGTTTA
TCTAAACTACCACCAAAGAAGACCGACTAGATTTACAATC
Chr coordinates Chr XV from 717086-718384
w3c xhtml validator w3c css validator