Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YOR203W
Strain S288c
Description Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; overlaps 5' end of essential DED1 gene required for translation initiation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YOR203W	6324777 upstream sequence, from -1000 to -1, size 1000
TTGTTTTTTTCTACTATTGCTTTGCTGTGGGAAAAACTTATCGAAAGATGACGACTTTTT
CTTAATTCTCGTTTTAAGAGCTTGGTGAGCGCTAGGAGTCACTGCCAGGTATCGTTTGAA
CACGGCATTAGTCAGGGAAGTCATAACACAGTCCTTTCCCGCAATTTTCTTTTTCTATTA
CTCTTGGCCTCCTCTAGTACACTCTATATTTTTTTATGCCTCGGTAATGATTTTCATTTT
TTTTTTTCCACCTAGCGGATGACTCTTTTTTTTTCTTAGCGATTGGCATTATCACATAAT
GAATTATACATTATATAAAGTAATGTGATTTCTTCGAAGAATATACTAAAAAATGAGCAG
GCAAGATAAACGAAGGCAAAGATGACAGAGCAGAAAGCCCTAGTAAAGCGTATTACAAAT
GAAACCAAGATTCAGATTGCGATCTCTTTAAAGGGTGGTCCCCTAGCGATAGAGCACTCG
ATCTTCCCAGAAAAAGAGGCAGAAGCAGTAGCAGAACAGGCCACACAATCGCAAGTGATT
AACGTCCACACAGGTATAGGGTTTCTGGACCATATGATACATGCTCTGGCCAAGCATTCC
GGCTGGTCGCTAATCGTTGAGTGCATTGGTGACTTACACATAGACGACCATCACACCACT
GAAGACTGCGGGATTGCTCTCGGTCAAGCTTTTAAAGAGGCCCTAGGGGCCGTGCGTGGA
GTAAAAAGGTTTGGATCAGGATTTGCGCCTTTGGATGAGGCACTTTCCAGAGCGGTGGTA
GATCTTTCGAACAGGCCGTACGCAGTTGTCGAACTTGGTTTGCAAAGGGAGAAAGTAGGA
GATCTCTCTTGCGAGATGATCCCGCATTTTCTTGAAAGCTTTGCAGAGGCTAGCAGAATT
ACCCTCCACGTTGATTGTCTGCGAGGCAAGAATGATCATCACCGTAGTGAGAGTGCGTTC
AAGGCTCTTGCGGTTGCCATAAGAGAAGCCACCTCGCCCA
Chr coordinates
w3c xhtml validator w3c css validator