Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HSH49
Systematic Name YOR319W
Strain S288c
Description U2-snRNP associated splicing factor with similarity to the mammalian splicing factor SAP49; proposed to function as a U2-snRNP assembly factor along with Hsh155p and binding partner Cus1p; contains two RNA recognition motifs (RRM)
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HSH49 YOR319W
ATGGACCCTGTCTCATTTGTTGAGTTGACAAAATATCAGGGAAATTGATTACCCTGGTGT
GCACTGACTCCTTAGTACTCATTTTCACAGCTTCGTACACATCATGGAAGACAAACCATA
GCAACCAGCCGCTCTCATTCAATCTCGCATAGACTGGAAGAAGAAGCTCCAGAAGCATAT
CCATTCCTTGCAAAACGTTCGTTTCTGCGTGCCTGTCTTCTCCACTTTTGTCTCGGTCAG
CCAACAGGCACGTGGTGGGTGTGCCTGGAGATTAGAAATTGTAGTTCCTCAGATTATGTA
AATTTTCTCAACAAATTTACTAGGACAAAGAAATGACGTAGTAAGAGTACTAAGTATCAA
GATTGTTGAGGTGTTCCGTTGTTAGTACTTTTTTACGAGCACGCGAAGTTGACACATTGT
GTCTGGCAGATGGGAACTAATTTACTAATCAATTTGCAGCAGTACGCTATCATGTGATGA
AATATATTCCCGTTGGATTAACCATAGTCTAATAGACAGTAATATCGAGGACTCAGGGAC
TACGCCATTTATTTACTTGGAATAATTTGCCTGCCCATTCAATAAAATTATGAAAATTGT
GACGTTCATACACATGCTGATGAAATGAGTATTTCTTTTAGTTGAAAATCCAACAAATTC
CTCATTAACGCCGTTTTCCCACTTCTATTTACTGGCTTTTCTTTCAAAACGAGGGGATTT
ATTCTTGGCGTTGTTGAAATTTTCACATTTCCAGAAGATTTATTCGGCGTTTATTTTTCT
AATCCAGATTTAACAAAGAGAACAAAATCCCACTCGTTACCCTGCCTTGAATTGTCAGAT
GGCCTTATTTATTTATTTGTTACCCGCAGATGTGGATATAAGACGGAAATGGATAGTAAA
GCTAAAACGACTCTTCAAGCAGAAATTACCGAGATGAGGTAAAAATGAATGGGCAAAATA
GCTAGCCAAGAACAGCGCAATCATTCTAAGATTAACATTG
Chr coordinates Chr XV from 912822-913463
w3c xhtml validator w3c css validator