Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GNT1
Systematic Name YOR320C
Strain S288c
Description N-acetylglucosaminyltransferase; capable of modification of N-linked glycans in the Golgi apparatus
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>GNT1 YOR320C
ATGAGGTTGATATCCAAAAGAAGAATCAGATTTATTGTGTTTATTTTGTTCGGCGTCCTC
ACTGTATTCGTAGTATCAAGACTTGTTGTTCATTTTCAGTATAACCAAGAAATAAAGTTC
TATAAAAAGTATTTTCAACAGAGGAAGGATGGGCTTCACGAAATTTACAACCCATTAGAA
ATCAAGCAAATACCCAAGGAAACGATAGATGACTTATATACCGCCCGTTTAGATAAAGAG
TTGAAAAACGGTGAGGTCATCGAGTGGTCCAAGTTTGCATACGTGAATTATGTGACTAAT
GCTGATTATCTTTGTAATACGCTGATCATATTCAATGATCTGAAACAGGAGTTTGAGACA
AAGGCCAAGTTAGTTCTTCTGATATCTAAAGATCTGCTAGACCCAAACACTTCCTCAAAT
GTGGCTTACATTAGTTCACTCCTTAACAAGATTCAAGCTATAGATGAGGACCAGGTAGTT
ATCAAGTTGATAGATAACATTGTGAAGCCAAAGGATACTACACCTTGGAATGAAAGTTTA
ACAAAATTACTAGTATTTAACCAAACAGAATTTGACCGTGTGATTTATCTTGACAACGAC
GCAATTTTAAGATCAAGCTTGGACGAATTATTTTTCCTACCAAATTATATCAAATTTGCA
GCTCCATTAACATACTGGTTTTTATCTAACAGTGATTTGGAAAAATCATACCATGAAACG
CGACACCGTGAAAAGCAACCAATCAACCTCCAGTCGTATACAAAAGTGCTGACTAAAAGA
ATTGGGAAAGGTCAGATGATTTATAATCATTTGCCGAGTTTGCCGCATTCATTGTACTTG
AATTCTAATAACATAGCTCAGGACATTATAAGTTCTACATCATCTTTATCGCCGTTATTT
GATTTCCAAAGTAGTAAAAAGGTTGGAAAATTAAAATTTGCTTCTAATTTAATGGTTATT
AATCCTTCAAAGGAGGCGTTTGATGAAATTGTGAACGTTATGCTGCCCAAGATTTTAAAC
AAGAAGGAAAAGTACGATATGGATTTGATCAATGAAGAAATGTACAATTTAAAGAAGATT
ATTTATAAACAGTTTATTTTCTTCAGAAAAGTCCGAAAACTTTTCAAACCAGAAGTATTG
GTTTTGCCATTTGCAAGGTACGGCTTACTGACGGGTTCATTGAGAAACCCACGGCACTAT
TCTATAATCTATAATGACGTTTTGGGTTATAAGACATTGGATAATGATGGCAACGATATT
CCGGTAGGATTAAACGACAGTGTCGCATATTCTAAGTACATACATTTTTCGGATTATCCA
TTGGCCAAGCCCTGGAATTATCCATCAATGAAGGAGTTTGAATGTATCGTTAAAGAAGAA
GACGCGGAGGATTCAAAGCTAGAGCACCAAGCTTGTGACCTTTGGAACTCGGTGTACGCT
TCTTACATACAGTCCAGGGAAATCTGCCTCGTTTGA
Promoter Sequence
Download FASTA
>GNT1 YOR320C
GTTCTCCATATCAAATCATCGTCAGTACTTTTTTCACTGTAGCCCGTCGCCACTCTGTAC
GGCATTGTCTGTTATTTTATTTGCCGGTATTTGGAGCACACAAATATTTGTTTTACTCTT
ATGTCGAAAGGAAGAGTTGGAATGCCCTTCTTTAGAGATTTTCTATTGTACACCGGCCAG
GTGGCCTATTATATTTGCCTTTCCTCGCGTCGCGATTTTCAATTAAAGGGCGCGAGTGCC
TAATCTAGATCTGAGCTTTGTTCTTAAACGAGTTCTTACAGGGTGGTAACTCATTCATTC
TTTACATATCCATTTTCGTTAACGCAAACATTCGTCAAGTCATCTGGAATACTAACCCGG
GACAGGTTCCTTTTAGCTGTAATGCCTCTAGGATGATTACTATAAAGAAATGTAACATAC
TTACAGAAAAGGGAAGTATTCTCTTAACAAGGCAGAAATTAAGAGAATACTACTTAGGAG
AGTAAACCTGTTGAATTTTTAAGCCGCAGTAAACGTTTGTATTCCTTAGTTATGAGGAAG
TTCAAGTAAACAGATTACTTACTTTTTTAGTAACATCCGGCAACCGTACCAGAATTATTA
CATTTATTCCAGAAGCATTTTCAAAAGTTTATTGCATTGGTATTCATTGGTAAGATCCAT
TCATTTGGAGAATATGCTTATGATACTTAAAAATTGGAAAAATAGCCGCCATCAACGTTT
TAGGGTTGCTCAACATTGGCGTTTAGGGTTTTGATAAAATGTAGGGCTTTTTAAAATATC
ACTTGTATACTCTCTCGTTCCGCTCAGCACGCGACCGTTTGAGCAAAACTAGCATCTGGT
ACACTATAAACTAGTGCTCGGTTCTCGTTCATTAGTGATGATCGTACTGTATCAGGCTGG
TGGATTAGTCGAAATCACCGGGAAACAAATACCGACCACTTGTGGACAACATTGTGACAT
TATTTGCTAAACTGTATACTTCGGAACTATCATTCCAATT
Chr coordinates Chr XV from 915094-913619
w3c xhtml validator w3c css validator