Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FRE5
Systematic Name YOR384W
Strain S288c
Description Putative ferric reductase with similarity to Fre2p; expression induced by low iron levels; the authentic, non-tagged protein is detected in highly purified mitochondria in high-throughput studies
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FRE5 YOR384W
TTCAGCAGTGGTGGTTGCAGTGGTTGAAGCAGAAGAGGTAGCAGCTTCTGAGCTGGTAGA
AGTACTACTTGGAGACCAGGTGTTGCTGCTGCCTTCACCAGTCCAGACAAAAGTAGCATC
TTGGGTGACAGTCTTAGTGTAGACGTGACCGTTCTTGGTGGCAGTGATAGTGGTAGTGAT
ACTAGAACCAGAACCTTCATCAGCAGAAGAAGTCTCAGCAGCAGAAGAAGTCTCAGCAGC
AGAAGTGGTAGCGGCAGCAGAAGTGGTAGCGGCAGCAGAGGTTTCGGCGGCAGAAGTTTC
GGCGGCAGAAGATTCAGCGGCAGAAGTGCTGCTGGCGTAAGAGTCTTCACCACCCCAAAC
AAAAGTAGCATCTTGGGTGACAGTCTTAGTGTAGACATGACCGTTCTTGGTGGCAGTGAT
GGTGGTGGTGATACTCTCAGCAAGAGCAGTAGCGGCAACAGCAGATAGAACCAAAGCGGA
AGAGAATTTCATTTTAGGGATTATTGTTATTAGTTATTTTTAAGCGAGTGGAAGTACTTG
TTTGTATCTGTTCGAACATTCATATTACCTCCTAATACTTCAAATAGTTCTTGGCTTAAA
TACCCCATAAATCAACTTTTACAAAAAAAAAAATAACAAATCTCGAACGATAATTGAACC
CCATTTTTTTGCACCCTTTCCTAGAATGGCGGAACTCGGCTCTTGAGCCCTTAGATTGCT
TTCCTTCACATACATCAAAAAATATGGGATAGCGGGGTGCGGAACAAACAGGGTGCAAAA
AAAAATCTAGGACATAGGTAGGACTAAGAAGACTGTGGCATTACTACACAGCAATCATAT
TTTACCGCTTCCTCGTTTAATTGGATTTTTACTTTTCATTACATTAGCGATCATTAAAAA
AGGAGCGTCAATTTTTTACTTGGCAAATGTGTAATGTAGCGTTTTCGGTATGTCACATCA
CCAATTTTGTCGCAGTTAATTTAATTCACCCAGATTTCGA
Chr coordinates Chr XV from 1061564-1063648
w3c xhtml validator w3c css validator