Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YOR389W
Systematic Name YOR389W
Strain S288c
Description Putative protein of unknown function; expression regulated by copper levels
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YOR389W YOR389W
CTGGCATGTCTTTTTCATTCGGAGTTCTAGTATCGGTGCCTTCCTAGTAAGGAAATTCCC
GATTATAAGGGAAAAAAAGAAAAGGGATAAGCCGCTTGGGCTGTTGGTCCAAACAGAATG
TTTTAAACCATAGCCAAACAAGTGCAAAATAGAAAAGTTGGGGTTAAAACTCTCTTTCAA
GCCTATCCTCGAGTGGTGACAAAATAGGTAATTTCCGACACTTTTTTCTGCTACTAAGCA
CCGTGAAAAGAGAACGTTTCGAGAGTACATTTCGTACTGAATGTTGTATAAACTCTATGC
TTCTAAAGATTTATCCAAACCGTTGGAGCTTTCCCTTTATTTCTACATAGGTTTCGAAAA
CGGTCTCCTACGGAGCTTCTCCTTTTATGGCGATCTGTTTTTAAAGTGTTTTTTAGAAAA
CCATTAAACTCGAGGCTTGGTTTATTTTTGCCTTCGAGATAATTTTCTCTTTTCCTAAGA
AATTTATGTTACGCCAACAAAGACAACTAATAAGGTCTCAGTTCCTCTTGATCGTTAGCG
ATAATGCTTTTTTTTTGCACTTGCGGAGTGTAAATATCTATAGAAAAATAAACCACTTGA
ACAAGGGGAGCTTCAAGAACCTTTATGCATATTATCGAAATTTTTAGAGAAAGGTTCACG
ATTCAAGCTTTGTTTACCAATGTGATGTATTACAGTGTTCATGTCACTTGCATTGACATT
GTCTTTACACCACATTAAACACAAGTTAACAACCGTTCTCCGGGCAAAGCGAGACGATGC
AGTAATCAGCGGCAATGAACTACGTATGTAAAAAAAAGATCGGGGTGTAAAAATTCTATG
CCAAGAAAAAAATTAAAAACAAAATAAAAAAAAAAAGAAACTTGCGGCTCTTCACTCTTA
AAAGACAAAAAGTATTAGGATGATAAAAAAAATTCATAAAAAAAAAAAATTCTATGGCCT
CAGTTCTCGAAGAGCCCATTTATAATTGTTTACATAAATA
Chr coordinates Chr XV from 1074213-1076087
w3c xhtml validator w3c css validator