Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HSP33
Systematic Name YOR391C
Strain S288c
Description Possible chaperone and cysteine protease with similarity to E. coli Hsp31 and S. cerevisiae Hsp31p, Hsp32p, and Sno4p; member of the DJ-1/ThiJ/PfpI superfamily, which includes human DJ-1 involved in Parkinson's disease
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HSP33 YOR391C
TCGATTTTTTCCTCACCTTGTTTTGGTATTTCTATTGCAAGACAAAGTGAAAGAAGAAGA
AGTGGTGGTAAAAAATAACTATATATAATGAAAATTGTAACCTGGTGGGAGTGCAAACTG
TAAGTGATAACCTGCCAGATCCATGTTTCTATTATATACCTAAGAACCAGCCAAGTTAGG
TAAACGAGGAGTCTTTCAATATCTCTTTTCTAGTGAGAATGTTATTTAGGTAAATGAACA
AGTTACCACTATACTACTCACCCCCTACACTTTGTTTGTGACCTCTCCCCTTATCCAGTT
CATCGAAACTTTTTTTTCAACTTGTGGCGATCTGTGACATTGTCTACTACAAGAACCGAT
TTTGGTTGATGTCTGTAAAAAAAACAACCTTACCTTTCCAGATCCAACTTTCCAGGAGAG
CTGCGTGAGTTTCAAATATTTACCATGTCGGAGAAAGCTCCCAAGTACTTCCTTGTTCTT
GTCATTTTTTCCTTATCTCCATCCTTTAAGGAAGGTATTTCCATTATGCGATTCTATAAA
TCCGAGCATGCGAGTATTTCTTTTCTTGGCGCGGAGTCGCTGATGACGCAATAGGCACAT
TCACGAACATCCAGGACTGGTAATCTTCTCGTCTTAAAGAAAATCCAACCACCAGTAAGA
AACTCTTGGGTAAAATGGGGTATCTGAAATATTGCATAGCTGCAAATGAAGATATTCAGT
ATCAGCATAGGTATTTTTATGGAGGATAGGTAAAGAGAAAGAAAAAAAAAAATATCTTTC
TGACTGTCGTTCTTGCAATTATCACAATTAGGGGACTTTAAAACCGATACTTGATATATG
AGCACAGTCAAGGGGTCGGTTCTTGAGATTTTAATGGAAAACAGGAAAGTTGCACATACA
GGTCTGCTTTTCTTTGCTTGCTCCAGACAACGATACTTAGAACTAAAACATATTTCTAGA
ACACTTTTCTCCTTCATTCAAAAAGAAAACTGGCCTTGCA
Chr coordinates Chr XV from 1079258-1078545
w3c xhtml validator w3c css validator