Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ECM23
Systematic Name YPL021W
Alias SRD2
Strain S288c
Description Non-essential protein of unconfirmed function; affects pre-rRNA processing, may act as a negative regulator of the transcription of genes involved in pseudohyphal growth; homologous to Srd1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ECM23 YPL021W
TTATAAGTTAGACATGCTCTTTGAATCTTTTACTTTGATATTTTATTCCGCATATATATT
CTTTTTTTCGCGTTCATAGTTTATTCACTCAAATTTTTCATATCATCCGCAATTCATCTT
CCACTTTTTAGCAGTAAAAATGACCAAATGAAGTTCATTTATTTTTGATTTTTTAACCGT
ATTTGGTGGAATCTGAGCGTGGCATTAGTGAATCATTTTAAGCCAAATTACCCGTGAGTT
TTTCTTAGAAGCGCACAATCATATTCATTATTAATAAATGCTTCAAATTCATCCTCTTGA
ATAAGGTCCAGAAATAATTTTGTCTCTTTTCCATTACCTATGTGGGTAAAAATTTTCTTT
TGCGACTAAGATTCAAGAGACCAAGTTTCTTTTCCACAACGATATATAATAAACCAAATG
GTACAAAGTAGGAAACAACAAATAAGGAAAGCTTTTTCTTAAGTAGATTTGTATATTTAT
CCAAGAATGAACGATGTGTCTCGTAAACAGTAATTCCTTTTAAATTTTATATTTCTTCTA
TTTTCTGAACTTTTTTACTTAAGAAAAAATTTGGAAATCATTACCTGTAGGATGGCTTAG
CTCTGATAATCAACCTACCAAAGTAGTTTGCAGTTATGTGCACTTTTCCCTTCATGTTAA
CATTATTCGGGCCGGTCTATTGTTAAATAATTAAGGGTCCATTTTAGGCACGGCGGATTC
ACAGAAAACCACGCAGTGCTCAACGTCATATACCACAAAATCCGTTTTCGTATTAAAAGT
GAATGTGTCAGTAAAAGGCATTCTTTTTAGCGTTCATTATTTCCTTTAATATGATGTACC
AATCTGTCCACTGCCTATGTAAACTTAAAAGGGAGGCATTTATGACTTGAGATTTGGTTA
AATTACCAATATCTCAAGGGTAACAATATTTGCTATACTGGTCATCTAGAATAAAAATAC
TGCGTTGTAGTGCTGAGTGATAGAACTTTTAAATCATATT
Chr coordinates Chr XVI from 511101-511664
w3c xhtml validator w3c css validator