Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YPL077C
Systematic Name YPL077C
Strain S288c
Description Putative protein of unknown function; regulates PIS1 expression; mutant displays spore wall assembly defect in ether sensitivity screen; YPL077C is not an essential gene; YPL077C has a paralog, YBR197C, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YPL077C YPL077C
TGGTACTACCTTATTCGTCACCGATAAATAAGTGGGTAGAATGATATTCAACTGAATACA
AATTAAAAGAAAACAGAATACGTCGATTGTGGTCGAAAGCCTCGATGATAGGACAGCAAC
AAGGGCGACAAGTATATTGGTGGAAAGGTTAGAGGGTTTATCTTTGGACTTTGTTGACGA
AATAACGAAAATGTACCATAGGGTCAGCCAAAAAGACAATGTCCATATGGAATCAGATGC
AGTTGTTTTAGAAAGAGATTTGAGGACTGGAGAGAGAGTCAACATTGCAAATGTGATAAT
CAGCGAAGACTTTACGTCCATGAATGAGGACAATAGAGGGTCGACTTTCGTCCTTGATAT
AATCAATGTTATAAATGAAAGGAAAATAGTTGGCGGAATAGGATCGAAGCCATAATAGTA
AATATATGTAAAAGTGATGTAAATGAAAGAAGTGTTCAATATGGTTTGGTAGAAACTTAT
AAAATCCAACCTAATTTGAGCGCGAGCAGCTTCTGATAATTTTCTATCAGACTTCTGGTT
ACTCTCAGCCTTTTGTCTTGCTCTCAACTCAATAAAACTTGGATCTGTATAATTATCTGG
GTACTCCTGTTTCAACCATAGTAGGCGCTTCCAGGGAGATCTTGTCATTGTACCTATTGA
AAATAACCAAATATAAACTATGAAGTCTCTTTAAGGTCATACGAAAATTGAGAGGATAAT
GGACCTGCAACAGAAAGTTTGGATGCCTCTGATTATATTCACCACCGTCTAACAACAATA
CTTAAAGTGTGATTGTACCTTTAAATTGGTTTAAAGCGAAGAGGTAATGGAAAGTTGAAA
TTTTCATTTTTAGTTCATAAATTTAGTAGCCGCGAAGTGGTCTCAAGTTCGGATATCAAG
ATAATCAATAGCCACGGACACCTACTACCTGGCCTTCGCTGACATGTAATTGACATTGTT
TTTGAAAAACCTAACCAAAAATTTACAATTCACTATCTTC
Chr coordinates Chr XVI from 410090-409368
w3c xhtml validator w3c css validator