Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YPL077C
Systematic Name YPL077C
Strain S288c
Description Putative protein of unknown function; regulates PIS1 expression; mutant displays spore wall assembly defect in ether sensitivity screen; YPL077C is not an essential gene; YPL077C has a paralog, YBR197C, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>YPL077C YPL077C
ATGAAAGATCTCCAGAAAAAAAGCTCAGTACGAAGGCAAATCACGAATGAAGACGATGAA
CGGTATGGGGAGGACAGCATCCATGACCTTCCCAGGACAATACCAAATGTAAATCCCTAT
ATTAGAAATTCAGGATTTAGGCCATCTTATTCTTCCCAAATTCCTTCGACAAGGAGTCTA
TTCAATAACTATTATAACCGTTCAAGTGCTAACACAGTTGGTAATGACACAATAGATACC
GATAGTGTTAGCTATAACGGAGTTGCCAAATTCCGGAGAAATAGCGTAGATATACCGCTA
CAGACACATAACAGACTGGAAGTACGGCCTATAATCGACAGACAAGACTATTTGTGGAGA
GAAATAGATGCCCTAGATGACGTTAAAAGACAGGCGCAGGCAACAGAATTGTATGATCAG
TTTCCTCCAGGGTTCGAGAACAAACTGATGCAATTAAGGCAAGCACATAGTAAACTACTT
CAAGTCTTGAGGGACCGCAATGCTAAAATAGAAGAGGAACAACGTCGTGAAGTGGCGGTC
GCAACCGCTGCTGCCATGATGACTAGAACGCCATCACCAACAGGAAAATCCGTCGGAGAT
GAAGCTACAAGCAACAACATGCATAGTAGCAGCGCAATTAGAAATCCAAATGGACCAACC
GTTGATCCTGAAGAAGGAAAGTACATTCAAGAGCTGGTGAACACTATAAGGGAATTACAA
TAG
Promoter Sequence
Download FASTA
>YPL077C YPL077C
TGGTACTACCTTATTCGTCACCGATAAATAAGTGGGTAGAATGATATTCAACTGAATACA
AATTAAAAGAAAACAGAATACGTCGATTGTGGTCGAAAGCCTCGATGATAGGACAGCAAC
AAGGGCGACAAGTATATTGGTGGAAAGGTTAGAGGGTTTATCTTTGGACTTTGTTGACGA
AATAACGAAAATGTACCATAGGGTCAGCCAAAAAGACAATGTCCATATGGAATCAGATGC
AGTTGTTTTAGAAAGAGATTTGAGGACTGGAGAGAGAGTCAACATTGCAAATGTGATAAT
CAGCGAAGACTTTACGTCCATGAATGAGGACAATAGAGGGTCGACTTTCGTCCTTGATAT
AATCAATGTTATAAATGAAAGGAAAATAGTTGGCGGAATAGGATCGAAGCCATAATAGTA
AATATATGTAAAAGTGATGTAAATGAAAGAAGTGTTCAATATGGTTTGGTAGAAACTTAT
AAAATCCAACCTAATTTGAGCGCGAGCAGCTTCTGATAATTTTCTATCAGACTTCTGGTT
ACTCTCAGCCTTTTGTCTTGCTCTCAACTCAATAAAACTTGGATCTGTATAATTATCTGG
GTACTCCTGTTTCAACCATAGTAGGCGCTTCCAGGGAGATCTTGTCATTGTACCTATTGA
AAATAACCAAATATAAACTATGAAGTCTCTTTAAGGTCATACGAAAATTGAGAGGATAAT
GGACCTGCAACAGAAAGTTTGGATGCCTCTGATTATATTCACCACCGTCTAACAACAATA
CTTAAAGTGTGATTGTACCTTTAAATTGGTTTAAAGCGAAGAGGTAATGGAAAGTTGAAA
TTTTCATTTTTAGTTCATAAATTTAGTAGCCGCGAAGTGGTCTCAAGTTCGGATATCAAG
ATAATCAATAGCCACGGACACCTACTACCTGGCCTTCGCTGACATGTAATTGACATTGTT
TTTGAAAAACCTAACCAAAAATTTACAATTCACTATCTTC
Chr coordinates Chr XVI from 410090-409368
w3c xhtml validator w3c css validator