Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GLR1
Systematic Name YPL091W
Alias LPG17
Strain S288c
Description Cytosolic and mitochondrial glutathione oxidoreductase; converts oxidized glutathione to reduced glutathione; cytosolic Glr1p is the main determinant of the glutathione redox state of the mitochondrial intermembrane space; mitochondrial Glr1p has a role in resistance to hyperoxia; protein abundance increases in response to DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GLR1 YPL091W
ACTTCTGGAGTCTTTATATTAATAAGATACCACCAATGACACAGGTTTTCACCTTATTCC
TGCTTTTGGGCCCGATGGGCCAAGGAAGTTTTGGAGTCTTATTGCTTACAGATAATATAA
AAAAATATGCGGGCAAATATTACCCAACAGATAACATTACAAGAGAACAAGAGATATTGA
CTATTGCAGTTCCATGGTGTTTCAAAATTCTAGGCATGGTTTCTGCTATGGCATTGCTCG
CTATGGGCTATTTTTTCACCGTGATTTCTGTCGTTTCAATCCTGTCGTACTACAATAAAA
AAGAGATTGAAAACGAGACAGGAAAAGTGAAGAGAGTTTATACCTTCCACAAAGGTTTTT
GGGGGATGACTTTCCCGATGGGTACTATGTCTTTAGGAAACGAAGAGTTATATGTGCAGT
ATAACCAGTACGTTCCCTTATATGCATTTAGAGTCCTAGGAACCATATACGGCGGTGTTT
GCGTTTGTTGGTCAATTCTATGCCTTTTATGCACATTGCATGAGTATTCTAAAAAGATGC
TGCATGCTGCCCGTAAATCTTCATTATTTTCAGAGTCAGGTACGGAAAAGACGACAGTTT
CTCCGTATAACAGCATTGAAAGCGTGGAAGAATCAAACTCGGCTCTAGATTTTACGCGTT
TAGCATAAAATTGTTGGTTTTATACGTACATAATTGGCAAGCATTTCATGTAGGAGTCTC
AATAGATAGTTTAATTCATTTGCACGGCGCTTTGCTGCTTTTGCTTCTTCACGTTGGTTT
TCACTATGCCTGATATTTTTTGACGTCACTTAGTAAGCACGACCCTTGTCAATTTTTCGA
GGATTTCGGAGCTTTCCATTTGGAATCTACTATTAAAATCAGTCTAAAAAAGTATAAGAA
ACACTTCTGGTTTTTCTCATGCGCTTCTCACTCTCAGTATATTTTGCTGCTTTCCTTCAT
ATGTATATATATCTATTTACATATTAGTTTACAGAACTTT
Chr coordinates Chr XVI from 375502-376953
w3c xhtml validator w3c css validator