Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TFB2
Systematic Name YPL122C
Strain S288c
Description Subunit of TFIIH and nucleotide excision repair factor 3 complexes, involved in transcription initiation, required for nucleotide excision repair, similar to 52 kDa subunit of human TFIIH
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TFB2 YPL122C
AAAAAGTATTAGCCGCCCAAACTTCTATGTACCTTCCGCATAAATAGGAAAGAAAACAAG
AAACTTGAACTTAAAATACTTCCACATCACAAGTATACTTTCCAGGAAAAGCACCAAATT
ACAGTTATCTAATAGTAATGCACAATCAGGAAGAGTGGCTAGACAAGGACAAAACTTTGG
TGAACGAAGAAGAAAATACTTGCATCAACCATTCTTATACAAAAAAGGACACTAATAACT
ATCGGGTCGGTAAAAGCGGTATTAAGGACTTGAAGAAGCCTACGAACCAGAAGGAAATTG
CGATAAAAAATAGGGAGTTAACGAAACAACTTACTCTTCTCAGGCAAGAAAATAATCACT
TACAGCAGGCTTGTAAAATTCTCAGCGAAAACAAGATCATTGAGAACAGAAAATCCATAG
AAAAATGGAGGACAATTTGTGAGATGGAACTGTCTTTTATTTTAAATTCCACTTTAATCA
AAATCAATAGAATGGGCGGCTATAAAGATTTTCTAGAAAAAGAAATGGAGGCTAAAAAGA
GAAGATTGGAATATCAGATTGACAACGGTATGGAAGATCAAATCTGTGAAATAAAGGAAA
GTGATGACTTTAGACAACTTTCAGAAGTTGAGAAACAAGAGTGGGAGAGTCAAATGAATG
AACAGCTGAAAGAGTTGGAAAAAAAAAAAATAGCGGAGCTGGAAAAATTGAATAAGGTGC
TGCATGATAGCGAAGGGAAAGATTTTGGAATGGCTGAACTATGCACTAGGTTAAAACTTG
ACTACAGCTTAATCTTTCCACAATGAAAAATGCGTAAAACGTTTATTCATCTTGCATTTC
TATTAGGTACGCGATTACTGAAAAAACGAATGTATTTTTTTGTTGTAGCGCAAATTACGC
ACCATCATATATTCACATATAACCTAACTTCATCGTCAGAATACAATACTAGTAACTTAG
CATTAAAAGCCACCATCAAAGGGAAGAAGTGAACAATATA
Chr coordinates Chr XVI from 320767-319226
w3c xhtml validator w3c css validator