Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YPL136W
Strain S288c
Description Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; completely overlaps the verified gene GIP3/YPL137C
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YPL136W	6325120 upstream sequence, from -1000 to -1, size 1000
ATCAGGTTCCTTGAAATAGTGCTCATGCATATGAATGGGCTTATCAATGCCGGCTTTTGA
GAGGTTTTCTGCAAGTTTATTATTCTCAAGCTCCCGATCAGCTTCAACATTTGGAGGTGA
CACCTCTTCTCTTTGCTTCGTAATGGTGCCTTCTGATGACTTTTCAGTAAGCTTACCGCC
TGCATCCGAAGCAGTCTTAAAATTGGCTACTTCAAAGGCTATTCTATTAGCAGCAAAATG
AGCTTCTTGCTGATGCTTAGCAGCCTCCCTTAAAGCCAACTTTTGATTTTCCAGGGCGAG
TATATATTCTTTAGACTTCTTAGTGTACAACGGTCCCTTAATGTTGGAATTGGTTGACTT
GGCCGATTGGTTGCTACTGGAAATACCCACGGAAATAGAAGGAACCTCGCTTATCATGTC
ATCAGGGATAAGGATGTTTCCCTTTTTTGGGGTTCTTGAAGGAAGTTGTTGGGGAGGATC
GGATTCGAATTTATCGACGGCAAACGAGACCCTTTTCAATGAAACTGTAGATAGGTCTTT
TACTGCAAGTGCAGGGGAGGGGAGTATAGGTGTCTGTGGCTTGCTAGCTGTTGGTGCCAC
TCCTCTCATTGGTGATGATATCTCCTTCACCCGTGGATCAGGAGTCGCAACTGCTTTAAT
GCCACCAGACTCATTCTCAGTCGTGCTAGTATTAACAACAGGTAATGGTTTCTTGGCAGT
GGAAGCTGAAGAAGAGGTAGACCGTTTGCTAAACAAAGATCCAAAAATCGACCTTTTAGT
CTTTTCTCCACTAGTCGAGTTGCTTCTCTTGAGAGTAGCATTAGATGGTGAAGAAATTGG
CGGGTGCTTTCCCTTGCCAACAGAAGAAGATGCGGTGGCGTTTATGGCAGAACTGGCCAG
TCTTGGTTTGGACGAGACCACAGCATTGGATATAGAAGTGGAACGTTTTTTCCTTACAAA
TTGAGTACTTGAGCCGTTGTCATCATTATCTATAAGGTCT
Chr coordinates
w3c xhtml validator w3c css validator