Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FRK1
Systematic Name YPL141C
Strain S288c
Description Putative protein kinase; similar to Kin4p; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm; interacts with rRNA transcription and ribosome biogenesis factors and the long chain fatty acyl-CoA synthetase Faa3
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FRK1 YPL141C
TCAGTAACTGGAGCTATAAATACAATAAGCGTTTTGTACGTAGAAAATATCCTCTATATT
GCCTGATTTTCTTTAGTTCCGACAAGGGCTCCGACCACGGGACAACCCTTATGATTTCTG
TTATAAGGCCTATTTGTTCTAGTTACGACGACACTTACTGCTGTCTCTTGACCGTTTTTG
CTATACTCATCCTCTTACCATTAAAAAAATAAAGAAAATGGACTCGAGTAAAGATGAAAC
CATATCTCTTTAATCACAACATACTCACTCTATGGGAGATTCTATTCTCCTTAGGTTAGT
AAATGGCATTATAAATTAGCAAGCGTAGCCTCTTCAGCCTATACATCAGCTGAACCTGCA
CAATTAATGTCATGTGGCCGACGTAATGCATATCCATCTTTTTTACTCCCTTAAAAGAAG
GTTTAGCCCCTACTGTATACTCAATGAACAGATAATGTCTATCCATAAAGTATATCATTT
CAGGAACCCTAAATAATAGTGCTATCGTTACATATACTTTTAAATTTCATATTGCATTAA
AATGCCGCACACCTTTTATGTAAACAAAGCCGCACTTCCTAAAAAAGCAATTGAAAACAA
TCGAAAGAATGAGTGTAGAACAGCAAAAAAGGTAAACAAGAGAAAAATTCTGAAACCCAG
ATCAACACCTGTTTCAACCCCTTCATCGATTTAAATATAATTCAAGTTCAGGTCATCGAG
TAAATCTATAATAAATCAGATCACAAAATCTGGTACACTGCTGTTGCTGATCACGGTTCT
TTTCATCTTTAACACATTTTCGCAGTTTTTTGACTGTGCCACATTTTGCATTAATTTGTT
TCTTGTGACGTGTTTGCGAGAATTTTTTGATTGCTAATTAAACCTAACAATAATCGCTAT
TTTTTTTACCCATCCACAATACAAGAAAGGCGAGCCAAGCGGCGTTCAATATTCAATTGG
CCATTACTTCTATATACTGATTTAGAGTGCCAAAAATTTA
Chr coordinates Chr XVI from 286061-283464
w3c xhtml validator w3c css validator