Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CBC2
Systematic Name YPL178W
Alias CBP20, MUD13, SAE1
Strain S288c
Description Small subunit of the heterodimeric cap binding complex with Sto1p; interacts with Npl3p, possibly to package mRNA for export from the nucleus; may have a role in telomere maintenance; contains an RNA-binding motif
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>CBC2 YPL178W
ATGTCCCTGGAAGAATTTGACGAAGTTAAATATGATCATTCAACTAAACGCCTAGATACA
CCATCAAGGTACCTGCTGCGCAAGGCTAGAAGAAACCCTAACGGGCTACAAGAACTGCGT
GAGTCGATGAAGTCATCCACAATTTATGTAGGAAATCTTTCCTTTTATACATCAGAAGAA
CAAATTTACGAATTATTCAGTAAATGTGGCACAATAAAAAGAATAATTATGGGTTTGGAC
CGTTTTAAGTTCACGCCATGTGGCTTCTGTTTTATTATATATAGTTGTCCAGATGAAGCA
TTGAATGCCTTAAAATATTTGTCCGATACAAAGTTAGACGAAAAGACAATTACCATTGAT
CTAGATCCTGGTTTTGAAGATGGAAGACAGTTTGGTCGTGGTAAGAGCGGTGGTCAAGTC
AGCGATGAATTGAGGTTCGATTTTGATGCATCCAGAGGTGGCTTCGCCATTCCATTTGCA
GAGCGTGTCGGCGTACCACATTCCAGATTTGATAACAGTAGCTCACAATCTAATACGAAT
AATTATATCCCTCCTCCTGATGCAATGGGTACTTTCAGACCAGGTTTCGATGAAGAAAGA
GAAGATGATAACTACGTACCTCAGTAG
Promoter Sequence
Download FASTA
>CBC2 YPL178W
CTTGTGTCTTCATACACTTAATATTGTTATCCTTCTTCAAGACCGGACTATATAAAGAAA
AAATTTTGTAATGCTATTATATTTCAACTTCAAATTATTTTCTACTAGTAGACATAATGG
AACTTCGCTCTCAGATAATCTATGGCGATAGATGGACAATTGACAATCTTCTGAAAGAAT
TTATATAATAAGATGTGACCATGACCTAAACCTGCTCACGCTCATGAAAGGATACAGGTA
ATTTGGCGAAACATTCCCAAGCTTCGCTGATAGACCTATCCCAGAAAGTGTCTGTTTAAA
ACTACAAGTATTTGCAGTTTTCGTTATCCAGTTTCGTTCAAGAGCATTAATGCACAAGCC
ACTTATATTATATAAATTTAAACTTTGGGAAAATATCATACACCTATTGTACCAGTAAAT
GTTGGAATAAAAATCAACTATCATCTACTAACTAGTATTTACGTTACTAGTATATTATCA
TATACGGTGTTAGAAGATGACACAAATGATGAGAAATAGTCATCTAAATTAGTGGAAGCT
GAAACGCAAGGATTGATAATGTAATAGGATCAATGAATATTAACATATAAAATGATGATA
ATAATATTTATAGAATTGTGTAGAATTGCAGATTCCCTTTCATGGATTCCTAAATCCTTG
AGGAGAACTTCTAGTATATCTATATACCTAATATTATAGCCTTAATCACAATGGAATCCC
AACAATTACATCAAAATCCACATTGTCTACAGTAAAAGTATACCACTAATAGATTTGTAA
TTGGTGTATGAAGTAGTGTATGGTATAAACGTTAATAAGTGCTTATCAAAGTATTACCCG
CTTTAACAGTTTTTGTGTTTTTTTCAAGAAAAATATTATATGTATGAATATAGAACATGA
GTTTATATGGAGAAAGTGTCTCGACAGCTTTTAAAGTCCCGAAAGGACTAATATCGAATA
AAAGTTGCATCCATTAATATACCAATAAATAAAGGGAAAG
Chr coordinates Chr XVI from 212158-212784
w3c xhtml validator w3c css validator