Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MRN1
Systematic Name YPL184C
Alias PTR69
Strain S288c
Description RNA-binding protein proposed to be involved in translational regulation; binds specific categories of mRNAs, including those that contain upstream open reading frames (uORFs) and internal ribosome entry sites (IRES)
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MRN1 YPL184C
CTTTTGGAATGCCCTTGAACTATGGACCTTTCACTCCCTATTGACAAATTCAAAAGACAA
AAAAGGGAAACACTTGGAAAAGGTAACTTGACGTCCAATAATACACGCCGAATGAGGGCA
GACTATGTCTTTCTTCCAACTGCCGTGGCAGTTGCGTACTTATCATTCTTATGTTCTTAC
AGTGGGATTCCACCATCATGGTAACCCGGTGCTTTTTTTCCTTGTGGTACGATTTTGGCT
ATGAGAAGAGAAAGAAAAGACAGAAAAAAACACGATCTTGAAATTAACTTTACCAGAAAG
TGGATCTTGTGGTTGTCCGAAAGTCTACAAAGAGATTCAGTCACAACCGCAATCATACTC
CATCCCTTCGTCACAGCAATAAATTAATCAGTTTCTTTGCCTTTGGTGGAAAGTAAAAAA
AACTAAACTTGGTTCAGCACAGCGCTATATCTACGAGAACACCGTTGCCCACTCTTATAC
ATTATTTTCACAGAGTCACATTCCCCACTGAATTCTCTCCTTAAGCTTCCTTTCTCTGTT
TATTTTACCAATTTACAATTTCTAGAACTGATAGTCTCTGTACCTTTCCTTTAGATACAC
ATACGCTTCATTTCTTTTGAACATTGTATTCTTCTATTTTCTTCGTTCTTCCGTTATTTG
ATATTTGCCCCTTTTTAAGTCTTCTGACTCACCTGTTCTGCTTTACCAATTAGGCTCCTT
AATTGGTTCAACTGTCCATTCCAGCCTCATATTTTTCACTTTATCTTTCTTCATCATTTT
TTTTGTCTAATTAATATCCGTTTCCAACTTCAATTCTCAAGGACACTCTTTTTTTTTTTG
AAAAAAAATATCATATTTTTCTTTGCTAATACTATTTTATTTTTTCAATTCTGGTCGTTG
AAGCCTTTTCTATTCAGATATTTCCTAAAGAAAAACAAAGAACTATCGTTGTATTTTTTT
TTTTCTTCACCATCACATACTACTTCAATTGCATTAAAAC
Chr coordinates Chr XVI from 197788-195950
w3c xhtml validator w3c css validator