Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NSL1
Systematic Name YPL233W
Strain S288c
Description Essential component of the MIND kinetochore complex (Mtw1p Including Nnf1p-Nsl1p-Dsn1p) which joins kinetochore subunits contacting DNA to those contacting microtubules; required for accurate chromosome segregation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NSL1 YPL233W
TAGTCTTCGGTAGGAGATAAATTACCTGCAATTAAAACGGCCACAACAAGCCCATAAATG
GCTAAGATACCACTCATAACCACAGGAATCAAAGACTTCATGATCAATTCCGGCTTGAAA
GTACCTATACCGGCGATACCAATACCTGACTTAGCTGTACCAATGGCAGCTCCCAAACAG
GAAAGCACCATGGCAGCTGCACAACCTGCGAACCCGAAAAAGGGAGCGTACAATGGAGCA
TATATGTTACTTGCGAGTTGCGTTGACATGTTTACAGAGAATAATAGAATGGACCCTTTC
CTCCTCCGACTCTTGCTTTGCTATATTTATTTTTTTTTTTCTTACGAGTAAAGAAGAAAA
TATTAGGTTATCTATGTTCCTTTTTCTAACTAATCACTCTTTCACTAAAGAATATTTCTT
AGCAAAAATATGCGTACCTGCGTACCGGGTAAAAAGTCGCATTGTCCAAGTGCTGCTGCT
TTTACGCAAAAGAACACATCTAACCGAAGAGGAATAAGCAGACCTGAACAATACCAAATA
AAGAAGTTACTTCTTCTTTATCACCATTTTGACAGGTTTCTACATTTTTTTTTCCGTAGA
GGGAAAACATATAAAAGCAGTCCAGTAATTGCTTGCTTTTTGAAATGGCTCTTTAAGCCT
GAAAGCACAAGACGATTAGTGATATAGATAATATATACACAGATACACATGTACGTACAT
AAGTACTGATTTAGGCTGCAACCTTTTACCTGGCTCAACTGACACGAATATTTTGTTATC
AGCCAAAATAAACGTTCATGATATATAGTGAGAAAAAAAGATCGATGGGACGACTCGCGG
CCATTCCTTGTGCGTGCAGGAATCAAGAAAATAAACAAACCGGTACAGTACAATAAGCAG
GCTGAGTAGGCGGAAAAAGTTTTATTCAGACGTGTACCGGAGCCTAAATCCTTTCTTACC
CATAGCAACCACACTAAATATATTATTGTAACACGAGAAG
Chr coordinates Chr XVI from 106172-106822
w3c xhtml validator w3c css validator