Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name THI21
Systematic Name YPL258C
Strain S288c
Description Hydroxymethylpyrimidine phosphate kinase, involved in the last steps in thiamine biosynthesis; member of a gene family with THI20 and THI22; Thi20p also has this activity
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>THI21 YPL258C
CATCTCTCATTATATGGGACGCTATCCGCTATCATCATCACAGCGGACACTCAGCTTCAA
GAGTAGCATTTAACATTATCGCATCAAGCTCAACAATCATCCATCGTTCGCTGGTATAAC
AAATTTGTTAAAACAAGGGGAGGTTCATTGCTACCTTCACGGGCAACTGTAACAACTGTC
CAAAACAAATATATGATATACAAACGTACAGTTTCTCTGTGTTTGAATTACTTTACCCTG
TTTAGAAGAGTGAAGAAATGATAAACCGTCCCTTTTATCATCGCTCACAGCAGGTTTAAT
GAAAGCTGAAACGAAAGGATTTATAGTGTAATGGGATAATGAGCGACAAAATACAATACG
AAAAAGAAGATGTGATATTGTTATATAGAATTATCGATTACCTTTGTGGATTCGAATATT
CTCGAGAATAACTTATAGTATATTCTTTATGCTCAATATTATAGCCTTTAACAACAACGC
ACTCCCAAGAAGTTGCTGTATAAATTTCACTAGCCTATAAAATTTCCAGAACTATCATGA
AAATGCTATGAATGTCCTCAAATATCCGAAAGAACAATGAAGGTAACCAAAAATAAAGTA
AATCGCTTTTGTTTTACAAGAAACGCGATTTTCATCATTTTATTACCGACTTAGAGTCCG
CTTCCCATATTTGCATATACACACGAAGTACCATAGTAACACACCATGAAAGTGCACGCG
ATTTTTTAGTAACTGCCAGGTCTGTTCTCACTTCGCGATCTCGTATTTCTTTAATGATAC
GTATATGTATAGCTTCTCTTTTCTGATAGATCGATGCATCCAGACTGAATATTGGAAACC
CTTAGAGCTACTCCATCTGGCAAGAGAAATGCTCTTATTTATAGGCACTAGCCAAACTAT
ACAAAGTTAGACGCAGCACCTGTTGTTTGCATCATTATTTATTCTTCCAAATCTGATCAC
GTTAGGAAATATACATAAGGAAAGCAACTGTCTTGCCACA
Chr coordinates Chr XVI from 55153-53498
w3c xhtml validator w3c css validator