Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YOP1
Systematic Name YPR028W
Alias YIP2
Strain S288c
Description Reticulon-interacting protein; ER integral membrane protein involved in the generation of tubular ER morphology; promotes membrane curvature; forms tubules in vitro; regulates the ER asymmetry-induced inheritance block during ER stress; role in ER-derived peroxisomal biogenesis; interacts with Yip1p to mediate membrane traffic and with Sey1p to maintain ER morphology; facilitates lipid exchange between the ER and mitochondria; forms ER foci upon DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>YOP1 YPR028W
ATGTCCGAATATGCATCTAGTATTCACTCTCAAATGAAACAATTCGATACCAAGTACTCT
GGTAATAGAATTTTACAGCAATTAGAAAATAAAACTAATTTGCCTAAATCTTATTTAGTT
GCTGGTTTAGGTTTCGCTTATCTCCTTTTGATTTTTATTAACGTCGGAGGTGTAGGTGAA
ATTCTTTCCAATTTTGCTGGGTTTGTGTTGCCAGCATATTTATCGTTGGTTGCTTTGAAG
ACACCAACGTCCACCGATGACACACAACTCTTGACCTACTGGATTGTCTTTTCATTTTTG
AGTGTCATTGAATTCTGGTCCAAGGCAATTCTATATTTGATTCCATTCTACTGGTTTTTG
AAAACCGTTTTCTTAATCTACATTGCCTTGCCTCAAACTGGTGGCGCTAGAATGATCTAT
CAAAAGATCGTAGCCCCATTGACCGACAGATATATCCTAAGAGATGTTAGCAAGACAGAA
AAGGATGAAATTAGAGCTTCCGTCAATGAGGCTTCTAAGGCTACAGGTGCTTCTGTTCAT
TAA
Promoter Sequence
Download FASTA
>YOP1 YPR028W
TCGAAAAAATAAATGCGAATTCTGTGGATCGAACACAGGACCTCCAGATAACTTGACCGA
AGTTTTTTCTTCAGTCTGGCGCTCTCCCAACTGAGCTAAATCCGCATATCAGAATGAAAT
AAACAAGCATTCTTGTGCTTTATAAATGGTCCAAGCGTCTAACTTTTAAAGAGTACATTC
TAAAAGTAAGAGACGAAGACAACATTATAATAATTTTCTCAAGACATATATGTTTCACCG
GCACGTTTTGTTTTGTCCCCTTTTATTTTGAGCCTGAATACTATGCTTTATAAAACTTTA
ATGCGCTCAACAAGTGCACCTTCCAACGGAAAAAAAGAAATTCAACAGGGAGCGATGCCA
TCATCACATGCACGTTTTCAAGTATTTATAAGACTTGCTACTTGCTCGTCCATTCATGAC
TTTAATGAGGTTCTAATTTATTGGTGCAACTCTTCAAACTAGCTGCCCAATCAGTGCTGG
AATGAGTGCCAAGACAAGCGACAAACCCTGTCAATCTCCTGAAAAACAAAAATTAAGTGC
TTGAGAAGACCTTCAGAAGAGTTGCATAGATAGGATGGGTGAGCGCAATTACTAGTTACG
CAGTAAGTAGGTTATATGGCTGCTGGAGGGGCAGTACTGATTTAATCACAATCCGGATTA
AACTTCCTCCTGAAAAAAAAAAAACTACATCAAGTCAAAAGATTTTCATTCACTCTTTGG
AAGGCTGTGTGGCATTCTAACCTTTATTTTTTTATCACCATTCTCGAATTTTCGTGGTTC
GCTTTCTTAGCGCCGTTATTCTCTCTTCTTGTCCACGTCAAAGGGAGTATGCGTAACCCC
TTTCAAGGTTGAACGAAAAAAAAAAAAATATGTCCTTCAAAATTTTTTTTGATTTAAAAC
TAAAAAACATTCCCTTGAAGCTTGTTATTCCGAAAGAAAGAATCTAAAATTGCAATTGGT
AGTGAAAACAAATAAACAAAGACATAACCGCACTCCAATC
Chr coordinates Chr XVI from 623527-623577,623711-624202
w3c xhtml validator w3c css validator