Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SUE1
Systematic Name YPR151C
Strain S288c
Description Mitochondrial protein required for degradation of unstable forms of cytochrome c
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SUE1 YPR151C
GAATGGTGCGGCGAGCGCAGTGGCAATGCCACCGCTGAAGAAAGCGATAGCGAAGATAAT
AGCGAAGACGATAGCGAAGTACTAGAACCAACAAAATACCATTATCTGGCACAAATTGTT
GCTAATGCGGGAACAATCGCACCCGACACCATCCCACAAGATATAAGGAAACAACAAAAA
GCGTTATACAAGGCCTACAAAATCAAGGAGTATATACCGTCGAAGCGCGACCAAGACAAA
TTCGTTTCCCAACTGCTGTTTTATTATAAGACGTTCGACTTGGAACAGCGGAAAGAGATT
TTCTGCGATTGCCTACGGGATCACGAACGAGACTTTACGGGGGCAGTCGAATCGCTGCGT
CAGGACAAAGAGCTTATCGACCGATGGCAAACACTTCTGAAAGCACCCGCGGACAGTAGT
AGTATAGAGGATATATTGCTGAGCATTGAGCACAGGTGTTGTGTCAGCCCAATAGTGGTG
ACGGAACCACGCTACTACGTCGTGGGCATTCTGGAGAAGACCGTGGTCTGGGTGCGGTGG
CTAGCCGCCGAGGTCGGGCCATCAAGCCGGTTTACCCCAGTGGGCGCGGGGAACGAGCCG
ATAAATCCGGAATAGGAAGGGCAGACCAGGGGAGCAAAGAGTGATTAAGCTTACGCACCT
GGTATGGACGTGATGGAAGTGGGGTGGTGATAGCAACCAGAATACGGTAGGGTCTTTACG
CTTAGTGTACCTATCGGTATTCAGGCTCTTTGCCAGTGATTGGGGCTGCGGGATCCGCCA
TCATATCTAGTCACTTTTGTATAAGAATGAATGATAAGAGCAGGTGCAATTTTCGGACTT
TAGATGTTTCTTGTGTTTCATTATTTATAGCACATTTATTTTTTCCCTCTGAGTGTGTGT
CTGCATGTATACATTTTAGTTGAATTATAGAGAGTAACGAAACACACACGCATACACGTA
TATACAAAGACATATATACGTACGGAAATAGTGAATAAGG
Chr coordinates Chr XVI from 831675-831055
w3c xhtml validator w3c css validator