Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YPR172W
Systematic Name YPR172W
Strain S288c
Description Protein of unknown function, transcriptionally activated by Yrm1p along with genes involved in multidrug resistance
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YPR172W YPR172W
GTCTATGCTAAACTCGAATCTCACGACAACTTCCAAGCCTTCTTTGCCTGAAAAACCTCA
AAAGCTACGGAATGCAAATTTGGCCGCCCATAAGACCAAACCAAGCATACCGCCAAAGAA
AGTGGAGTTGAATATAGTATTACCTGAGCTACGTCCCGTAGAAACTTCTCCAACAAAGCA
GAACTTCGAAAACTCAATCGATTTGCCCAAGTTACGATCCAGCAACCGTAACATTAAAAA
AGAAGAGGAGGACAGTATTCCAGAAGCAATAAAAGGTATACAAAATCTGAAGAAAACCAA
ACAGCAGAAGCCTGCAATCCCTCAGAAAAAATCATTTCTAACAAATAATTCGAAAAATAC
TACACTCAAAAATGGTGATGATATTAACAAGTTAAATGACGAAATTGAAGCTCTATCATT
GCGGAATAACCTGAAGAAACGGCCACCAACGGCGCCACAACGTAAAATTTCTTTGCCAGA
GGCATTGCGAAAAGTCGAATTGATGAAAAAATCTAAAACCGAGCCTGTTTTAGAGTCCTC
AAACGAACTGAGCATAAACGCAAAATTAGACGCAATAATTGCCTCTAGAAACTTAAGAGC
ATCTAATACTCTACCAGAACTTAGCGGTGTTAACACTAATATTGCAACTTCTGACAAGTA
TACTACTTCTAGAGATGAAACAGTGAAGGAAACTAAACCATTAGTTCACCCGAATAAAAA
TAGGACTCGTGGTCCCAGAAGAAAACTTCCAACACGCGTGTAACTACAGAGTAGACCTCC
GTATTTTACACATGTATGTACGTACATATGATGTAACAATAATATGATAATTTAATGGGA
TACATGTATTATCGTCACTTCCCACGTTTGCGCTTTGACATTTGCTCCCCTTATGAACCT
GAAGGAATATAAATCATCGATCTTTTTGCTACACTTTTCCTCCCTTATTAGAAAATAGCA
GTAAAATTACAGGCTATTCAAACCCTGAAACATCTCAATT
Chr coordinates Chr XVI from 885796-886398
w3c xhtml validator w3c css validator