Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HPA2
Systematic Name YPR193C
Alias KAT10
Strain S288c
Description Tetrameric histone acetyltransferase; has similarity to Gcn5p, Hat1p, Elp3p, and Hpa3p; acetylates histones H3 and H4 in vitro and exhibits autoacetylation activity; also acetylates polyamines
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>HPA2 YPR193C
ATGTCCAACACTAGCGAAGATAACATTACCGTAAGGTTTGTAACCGAAAACGATAAGGAG
GGTTGGCAAAGGCTTTGGAAATCCTATCAAGATTTTTATGAAGTCTCTTTTCCCGATGAC
TTGGACGATTTCAATTTCGGCAGATTCCTAGATCCTAACATTAAAATGTGGGCAGCCGTA
GCTGTGGAAAGTTCGAGCGAAAAAATTATTGGAATGATAAACTTTTTCAACCATATGACT
ACTTGGGATTTCAAGGACAAGATATACATCAACGATCTCTATGTTGATGAGAATTCTAGG
GTCAAAGGCGCGGGCGGCAAACTAATCCAATTTGTCTACGACGAAGCTGATAAACTGGGC
ACACCAAGCGTGTATTGGTGTACGGATGAGTCAAACCATAGAGCTCAGCTGCTATACGTC
AAGGTCGGCTATAAAGCCCCAAAAATATTATACAAGAGGAAGGGATATTAA
Promoter Sequence
Download FASTA
>HPA2 YPR193C
CGTTGGCTATCCTCTAAAGAACATAACTGATACAGCAAATGGCTATTTCGGCTATGCTCC
AGGACACTATCCATGACTAGAACTTTTCTTAGAACGCTATCATTTCTTTATTTTTTTTTC
TCCCCTGCACTTGTCTTTTCTATCAGTCACCTGCATGTATTTAGTTTTTATTCTTCTATC
TATAGTACAGAGTTACTTTGATATGTAAAAAGCCATCATTTTGTCTTCATACCTGCCAAA
ACTATAACAGTACACTCTAGTTCAATATTTTTGACACTTTTCATGCTTCTCGCCTTTTCT
CTGTGTATGCGGATGTTATCAATAAAGAAAAATGCTTTGATACCAGAATAGGAACTACAT
TTTTTTTTGGCTCATCGACGAAGTGATAAGGAGCCTGGCAATTGAAAATCAATCAAGAAT
ATTTTTTGCTTCCAACTACAAGTAATGATGGTGTTTATTTTGCATGAATTTTGGTATTAT
TGCAGAAATACAAGTGGTAAATAGTTTTGTAAACGTATATTTCAAGTTGGAATGAGATGC
GTTGCACTACTGGATAATTACTCCGGTTGAAGCATATTCAAATACAGTATCACCGTTTTT
TGGGATGATTCAGGGTTAAGCCAGCCGAGTATTGAGAGAGATTGACAACATAGCATGCGG
CTGATGTCAGATTTCGAACATTTGAAATTTTCTTGCCTTTATAAGACGTTTGCGAAATAC
AAGTTACAGGCCGACTACACAATGTATTTATTTCTATTTAATTTCTGCATTGGGTTAGCC
TTTTAACGTCATAGTTCATTGTACTTCTCAGTCACTTCTTGATTTGCTTTTATTGGTTGA
ACATTTTTATGGACGGAACTAACGGGTGGCAAGAACTACCAATTATATTAGGGGAGCGGC
AATCATTAAGAGAGGGAACGCTATAAATAGAGCAAAAAGGGCTAAGTATTGCTCTTAGTA
TTTTATATGCCAAGAAAGCAAACAGCCCTTTCTGTGTAGC
Chr coordinates Chr XVI from 923379-922909
w3c xhtml validator w3c css validator