Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Search by DNA motif > Result > View in Promoter Contact/Credits     Tutorial     Help

 

View Consensus in Promoter

Warning! Overlapping consensus sequences found in either strands may not be highlighted correctly!
Standard Name LRP1
Promoter Sequence

Consensus
CACGTK: -165
>LRP1    upstream sequence, from -1000 to -1, size 1000
TTTCCATGGGATCTATAACGATTGGAATATTGAATACACCTTGGCTATGCGCTAAGGAAG
ATGCCGCCGCCTTTTGAGATCCTTTTGCAGGAGATTCCGTGAAAGTTTCGGGCTTAAGTA
AAGACGGAATATCCGGATTTCCTCCTACTCTTCTGAATCGCTCAGCACTGGCTGTTGTGC
TAACATTCTCTCCTGTAGTATTATTTAAAAAATTACGATCCTTCTTGTGCTTACGTTTGA
CTCCAATTGTCCTTAAAAAGGCAGTGCCCCAATGGTGCTTCTTTTTTGAATCTCTAGTCA
TTACTGTATATTTTCAACACTATCCATGGAGAGTAAGAACCACACACAGTAGCAATAATT
TAATATCAATGGCAATAGCAACGAAATTACAGTAGATACCGTGAGCCAGCAGAAACAGAT
TGATATTTCGTATTTCAAGAAGGCAGAATCATTCAACCACCTACCGTCCCCCAGGAGGAC
AGATCCCAACGAGGGACCTTTGCGCCCAATTCTACTCCTGCAAGGGTTTCACTTAGAAAT
GCTTTTGCCAAGGTAAAGGACCCCTAAGACTAGAATGAACTACGCCGGTCCGTCCGGCCG
TCATACTCCGTGGAAATTTACTTCTAAAAGGAGAAACAGCGATCTTTGCCGCATAAAGCC
AGCCACTACTGGCGTGGAAAGATTTTTAGATTAGAAGACAATACAAAGCGGCAACGTCAT
AACCTTGGTATTTATTGGGCAAGCATTTTCATATCAGCGTACATACACCAGCAATGGGAA
TGTAAAGAAGAGTCGTTACTAGCATATTTTCTATTCATGCGGGTACCCAACATGTCACGT
T
TCACGAATTCTCGTGCAGTTTTTCAGCGATGAGCTAAGGCAGATGGTTATGGACTGTGC
CTTCTGTAGTCTGTGGAAGAAAAAACTGGTTAACAGCCTACAGTAGAAATCGATTAATAT
AAACATATATCTAGCAACGTAACGGAGTATTAGATCAGTA
Promoter Sequence
Complementary Strand

No match found!
>LRP1	Upstream Sequence Complementary Strand
AAAGGTACCCTAGATATTGCTAACCTTATAACTTATGTGGAACCGATACGCGATTCCTTC
TACGGCGGCGGAAAACTCTAGGAAAACGTCCTCTAAGGCACTTTCAAAGCCCGAATTCAT
TTCTGCCTTATAGGCCTAAAGGAGGATGAGAAGACTTAGCGAGTCGTGACCGACAACACG
ATTGTAAGAGAGGACATCATAATAAATTTTTTAATGCTAGGAAGAACACGAATGCAAACT
GAGGTTAACAGGAATTTTTCCGTCACGGGGTTACCACGAAGAAAAAACTTAGAGATCAGT
AATGACATATAAAAGTTGTGATAGGTACCTCTCATTCTTGGTGTGTGTCATCGTTATTAA
ATTATAGTTACCGTTATCGTTGCTTTAATGTCATCTATGGCACTCGGTCGTCTTTGTCTA
ACTATAAAGCATAAAGTTCTTCCGTCTTAGTAAGTTGGTGGATGGCAGGGGGTCCTCCTG
TCTAGGGTTGCTCCCTGGAAACGCGGGTTAAGATGAGGACGTTCCCAAAGTGAATCTTTA
CGAAAACGGTTCCATTTCCTGGGGATTCTGATCTTACTTGATGCGGCCAGGCAGGCCGGC
AGTATGAGGCACCTTTAAATGAAGATTTTCCTCTTTGTCGCTAGAAACGGCGTATTTCGG
TCGGTGATGACCGCACCTTTCTAAAAATCTAATCTTCTGTTATGTTTCGCCGTTGCAGTA
TTGGAACCATAAATAACCCGTTCGTAAAAGTATAGTCGCATGTATGTGGTCGTTACCCTT
ACATTTCTTCTCAGCAATGATCGTATAAAAGATAAGTACGCCCATGGGTTGTACAGTGCA
AAGTGCTTAAGAGCACGTCAAAAAGTCGCTACTCGATTCCGTCTACCAATACCTGACACG
GAAGACATCAGACACCTTCTTTTTTGACCAATTGTCGGATGTCATCTTTAGCTAATTATA
TTTGTATATAGATCGTTGCATTGCCTCATAATCTAGTCAT
w3c xhtml validator w3c css validator