Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Search by DNA motif > Result > View in Promoter Contact/Credits     Tutorial     Help

 

View Consensus in Promoter

Warning! Overlapping consensus sequences found in either strands may not be highlighted correctly!
Standard Name PFA4
Promoter Sequence

Consensus
AGAANTTCC: -291
>PFA4    upstream sequence, from -1000 to -1, size 1000
GGGCGTTTGCATGTTTAATATTGAGTAGCTCCTTTCATTGTCTAAAGAGTCACTCCTTAA
GAATTGCTACCTTAGGAAATAAGTTGGACTACCTTGGTATTTGTATATTGATTGTTACGT
CAATGGTCAGTATTTTGTACTACGGCTATTTTGAGAAATTTTCCCTATTTTGCCTATTTG
CGCTTATTACCGTTAGCTTTGGGATCGCGTGTAGTATTGTGTCACTAAAAGATAAGTTTC
GGAAAAGAGAGTGGAGACCTTACAGAGCTGGGCTATTTGTTTGTTTTGGTTTATCCTCAA
TTATTCCAATATTCAGCGGCCTTTACTGCTATAGTTTTTCAGAAATTTGGACCCAAATTC
AGCTCTTTTGGGTATTACTTGGGGGTGTCCTATATATAATTGGCGCTGTTCTTTATGGAA
TGCGGTTTCCTGAAAAGATTTGCCCCGGTAAATTTGATATTTGGGGTCATTCTCACCAAC
TTTTCCATTTTCTAGTTGTTATTGCGGCATTGTGCCACTTGAGAGGTTTATTAAATAGTT
ATGAGTTAGTCCATATAAAGATGGAGAACGGGATTGTCTCCTAGATATTTGGAAAAAACG
TAGGATTTATATAGAAAGTAGTTTTAAAGTTAAAATAATAAAATGGTTCTTATATGTGAG
AAGAGAATAAAGAAAAAGGCCCTTACAATAATATGTTCAAATATAGAAAAGAAATTCCCA
GATAGAAGGGAAGCAGGATTTGTGCACTTTCTCATATGAAATATACACGACTTTAGCGTC
TCAGAGGAACATTTTTCTTACTAAGAGCTCTCAATTTAAAATACGGCTTATTTCCACTAT
TTATTGGCTGTCTCATGTATATTTTTATTATCCTGTTAAACCTACCTCTCTTACTACGCG
CTTATGAAAAATAGCGGATCTGAGATACGATAATTATCGTCCCTACATTGTGGTGATGGT
GTATAACATGAATTTTAAAAACTGAGTTGATCGTTAAACC
Promoter Sequence
Complementary Strand

No match found!
>PFA4	Upstream Sequence Complementary Strand
CCCGCAAACGTACAAATTATAACTCATCGAGGAAAGTAACAGATTTCTCAGTGAGGAATT
CTTAACGATGGAATCCTTTATTCAACCTGATGGAACCATAAACATATAACTAACAATGCA
GTTACCAGTCATAAAACATGATGCCGATAAAACTCTTTAAAAGGGATAAAACGGATAAAC
GCGAATAATGGCAATCGAAACCCTAGCGCACATCATAACACAGTGATTTTCTATTCAAAG
CCTTTTCTCTCACCTCTGGAATGTCTCGACCCGATAAACAAACAAAACCAAATAGGAGTT
AATAAGGTTATAAGTCGCCGGAAATGACGATATCAAAAAGTCTTTAAACCTGGGTTTAAG
TCGAGAAAACCCATAATGAACCCCCACAGGATATATATTAACCGCGACAAGAAATACCTT
ACGCCAAAGGACTTTTCTAAACGGGGCCATTTAAACTATAAACCCCAGTAAGAGTGGTTG
AAAAGGTAAAAGATCAACAATAACGCCGTAACACGGTGAACTCTCCAAATAATTTATCAA
TACTCAATCAGGTATATTTCTACCTCTTGCCCTAACAGAGGATCTATAAACCTTTTTTGC
ATCCTAAATATATCTTTCATCAAAATTTCAATTTTATTATTTTACCAAGAATATACACTC
TTCTCTTATTTCTTTTTCCGGGAATGTTATTATACAAGTTTATATCTTTTCTTTAAGGGT
CTATCTTCCCTTCGTCCTAAACACGTGAAAGAGTATACTTTATATGTGCTGAAATCGCAG
AGTCTCCTTGTAAAAAGAATGATTCTCGAGAGTTAAATTTTATGCCGAATAAAGGTGATA
AATAACCGACAGAGTACATATAAAAATAATAGGACAATTTGGATGGAGAGAATGATGCGC
GAATACTTTTTATCGCCTAGACTCTATGCTATTAATAGCAGGGATGTAACACCACTACCA
CATATTGTACTTAAAATTTTTGACTCAACTAGCAATTTGG
w3c xhtml validator w3c css validator