Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SWC3
Systematic Name YAL011W
Alias SWC1
Strain S288c
Description Protein of unknown function, component of the SWR1 complex, which exchanges histone variant H2AZ (Htz1p) for chromatin-bound histone H2A; required for formation of nuclear-associated array of smooth endoplasmic reticulum known as karmellae
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SWC3 YAL011W
AATTGATAAAGGAAAACACCAAATTGGTCTGGATCGAAACCCCAACCAACCCAACTTTGA
AGGTCACCGACATCCAAAAGGTGGCAGACCTTATCAAGAAGCACGCTGCCGGCCAAGACG
TGATCTTGGTTGTCGACAACACCTTCTTGTCCCCATATATCTCCAATCCATTGAACTTCG
GTGCAGACATCGTTGTCCACTCCGCTACAAAGTACATCAACGGTCACTCAGACGTTGTGC
TCGGTGTCCTGGCCACTAATAACAAGCCATTGTACGAGCGTCTGCAGTTCTTACAAAACG
CCATTGGTGCTATCCCATCTCCTTTCGATGCTTGGTTGACCCACAGAGGTTTGAAGACTT
TGCATCTACGTGTCAGACAAGCTGCCCTCAGCGCCAACAAAATCGCTGAATTCTTGGCAG
CAGACAAGGAAAACGTTGTCGCAGTCAACTACCCAGGTTTGAAGACACACCCTAACTACG
ACGTAGTGTTAAAGCAACACCGTGATGCCCTTGGTGGTGGTATGATCTCCTTCAGAATCA
AGGGTGGTGCTGAAGCTGCTTCCAAGTTCGCCTCCTCCACAAGACTGTTCACATTGGCCG
AATCCCTTGGTGGTATCGAATCTCTATTGGAAGTGCCCGCTGTGATGACCCACGGTGGTA
TCCCAAAGGAGGCCAGAGAGGCCTCTGGTGTTTTTGACGACTTGGTTAGAATCTCTGTCG
GTATTGAAGACACTGACGATCTTTTGGAAGACATCAAGCAAGCCTTGAAACAAGCCACCA
ACTAATCGCCAGTGCCACGTCTCTGCCTTCGACCGGACCTTTTTAAGTACGATAAATATC
CTTTTATAAATATATAGTCTAAAATATCCATTAATACTGTGCTCAATCAATCGTGTTAGA
TGATTTAGTTTTTTCCAAATCGTTATTATAGTGCAGAAGTAGTATACATAAAGGCATATG
CATGCGATTTGGAAGTAACGCTCGCCGTAGACAAGTAAGA
Chr coordinates Chr I from 132199-134076
w3c xhtml validator w3c css validator