Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DEP1
Systematic Name YAL013W
Alias FUN54
Strain S288c
Description Transcriptional modulator involved in regulation of structural phospholipid biosynthesis genes and metabolically unrelated genes, as well as maintenance of telomeres, mating efficiency, and sporulation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DEP1 YAL013W
CAACAGGAGCACCACTATCAGCACAAGAATAATCACGCAGTTGCCGTTATCCTTGAACCT
AGAATTGTTAAAGCCATGCATGGACCGAGAGGCCCTGTTCAAATTCCTACCATTATTATC
AATCAGGTTTTCTAAATCAACCAGCAGCGAGTCGTTCTGAGAAACGATCTCATTATTAAG
GTCCAGCGAAATGTCATGAGTCCTCCCAATAGACTGAGACAGTGCGCCCAAGTGGGAATC
TTGCTCTAACAACTGCTGTTGCTGGTTAATAAATAGTTCTTGGTTGGAAACCATGGGTTG
TGGTGGCTGTGGCTGTGACTGTGACTGTAACTGCGATTGCAATGGTTCATCCTTGTATGG
AGTATGCGTCGAAGGCAGCGGCGACTCCTCGTCTTGTTCATCGTCATCCTTATACATGAC
CGTAAGCTCGTCATCATTCTTGAACCGCACTTTTTTCAAAGACTCTTTGGACACCTCATC
AGTATTTCTTGCCACCTGCTGTTGGAACCTATACAACTCCTTGTCAACCGCCGTATCAGG
AATTTTGTCCAGTATGGTATTGTATCGGGATATTAGTTCATCATTGGGCGCACACTTCTG
CAATAACTCCAATATTGAGCCCAATTGCCGTTTCAAAGTAACGTTATCGTTTGAGGTCGG
GGCGAGCTTCAACACCGACACTAGCCTTGTTCTTTCTTCGACCAGATCAGAGAGCTGGTC
CAGTTCATAACCCAGCTTCAACACATCCATACCGTGTGTGCTTACGCATCTATTTGCTGT
CGTGAGATCTGTCTCTATGCTTTATTCGTTTTCCATTGTAAAGTCTCAGCATTTATTTCT
TGTTCTTTACTTGTTTTTGCCCTTTCGGGTGATCAAAGTCGTGCTGGGAAATTTTATTCT
TATAAAATGATTTTTAGAAATAATAAACTCATAACAGTGCAACGGCAAAGTACAAGGGAA
GGAAGCACAGAAGCAAGAGGAGGCGCATCGATCGTGGCAG
Chr coordinates Chr I from 129270-130487
w3c xhtml validator w3c css validator