Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PSK1
Systematic Name YAL017W
Alias FUN31
Strain S288c
Description One of two (see also PSK2) PAS domain containing S/T protein kinases; coordinately regulates protein synthesis and carbohydrate metabolism and storage in response to a unknown metabolite that reflects nutritional status
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PSK1 YAL017W
ACCAGGGCAAACATTATCAAGTAACTCGATAATATACCTAACATAGTCGTTGAGTAACTG
CTCTTATTGGTGTTGAACTCTAAAAACCCTTTGAACGGGTACATGAATGCACCTCCTGTG
AATGCATCTTTGAAAAAGTTCATTAGCACGTATCTGGTACGGCTCATAACTTTGCTGAAG
TGCTTCTTGTAAACTTTATCCAAGTACTGATTGAAGGGGATGTTGACATATGGCAGTTTT
TCATACGATTGGCCTCCGCCAAACTTGTACACCAAACCACCAATACCTGCCAGCGCTAAT
GAACCTGTAAAACTCATTTCCTGTTGTTGTTATTGTTTGTATAATGTACCTTTGTTCCCT
ACACTATAACAACACTTATTCGTGGCAAGAACGAAAATAAAAAATGATTTGAAACTTCCT
TTTCCACATCTATATCTATATATATATGTATATGTATAATACTTATTACTATGATATTAT
TCCATGTGTCACAAAACCAGAAAGATCCCGTCGTATTATTGAGTCACGTGCTTTATTCCA
TGGCGGGTAATAAATATTAAAACAAGGGTTTTTTAAGTAAATGATTACATGCTAAGGAAG
TGGTGAATAAGATTTGGCAAGGGGCAGGTCGCTAACCACAACATAGCATTCGTTGAAAAG
GAAATCAACGTTACAAAGTGCAGTTTTTTGTATTATTTTCCTATTATCCTCTTCTTTTCC
TTTGTTTCAGGCGTCGTTGCACCTTTTTGCTATACAAAAGCTCATAAAAGATTAGAAACC
CCGGATATCGTCACAACAGCGGTATATTATAGTTATTTTGCATCTTTTTGGTAAGTCAGA
AATTAGAAACAGTAGCTTACCAATTGAGTGAAAGTTTCCGTTCGTCATCTCCCTCTTTTG
TTTTTTTTCACCTTTGTTTTTCTGTTTCTTCTATTTTTGTTTTGTTTTGTTTTGTTTTGT
TCTCTCCCTAATTTGCATATAGGTAAACATCAAAGAAGTA
Chr coordinates Chr I from 120225-124295
w3c xhtml validator w3c css validator