Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PSK1
Systematic Name YAL017W
Alias FUN31
Strain S288c
Description PAS domain-containing serine/threonine protein kinase; coordinately regulates protein synthesis and carbohydrate metabolism and storage in response to a unknown metabolite that reflects nutritional status; PSK1 has a paralog, PSK2, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PSK1 YAL017W
ACCAGGGCAAACATTATCAAGTAACTCGATAATATACCTAACATAGTCGTTGAGTAACTG
CTCTTATTGGTGTTGAACTCTAAAAACCCTTTGAACGGGTACATGAATGCACCTCCTGTG
AATGCATCTTTGAAAAAGTTCATTAGCACGTATCTGGTACGGCTCATAACTTTGCTGAAG
TGCTTCTTGTAAACTTTATCCAAGTACTGATTGAAGGGGATGTTGACATATGGCAGTTTT
TCATACGATTGGCCTCCGCCAAACTTGTACACCAAACCACCAATACCTGCCAGCGCTAAT
GAACCTGTAAAACTCATTTCCTGTTGTTGTTATTGTTTGTATAATGTACCTTTGTTCCCT
ACACTATAACAACACTTATTCGTGGCAAGAACGAAAATAAAAAATGATTTGAAACTTCCT
TTTCCACATCTATATCTATATATATATGTATATGTATAATACTTATTACTATGATATTAT
TCCATGTGTCACAAAACCAGAAAGATCCCGTCGTATTATTGAGTCACGTGCTTTATTCCA
TGGCGGGTAATAAATATTAAAACAAGGGTTTTTTAAGTAAATGATTACATGCTAAGGAAG
TGGTGAATAAGATTTGGCAAGGGGCAGGTCGCTAACCACAACATAGCATTCGTTGAAAAG
GAAATCAACGTTACAAAGTGCAGTTTTTTGTATTATTTTCCTATTATCCTCTTCTTTTCC
TTTGTTTCAGGCGTCGTTGCACCTTTTTGCTATACAAAAGCTCATAAAAGATTAGAAACC
CCGGATATCGTCACAACAGCGGTATATTATAGTTATTTTGCATCTTTTTGGTAAGTCAGA
AATTAGAAACAGTAGCTTACCAATTGAGTGAAAGTTTCCGTTCGTCATCTCCCTCTTTTG
TTTTTTTTCACCTTTGTTTTTCTGTTTCTTCTATTTTTGTTTTGTTTTGTTTTGTTTTGT
TCTCTCCCTAATTTGCATATAGGTAAACATCAAAGAAGTA
Chr coordinates Chr I from 120225-124295
w3c xhtml validator w3c css validator