Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DRS2
Systematic Name YAL026C
Alias FUN38, SWA3
Strain S288c
Description Aminophospholipid translocase (flippase) that maintains membrane lipid asymmetry in post-Golgi secretory vesicles; contributes to clathrin-coated vesicle formation and endocytosis; mutations in human homolog ATP8B1 result in liver disease
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DRS2 YAL026C
GAAAGGCATTGGTAGCTGCCAAGATTGAAAAAGCCATCGAAAAAGAATTGATGGACAGAT
TAAAGAGTGGTGCTTACGGTGATAAACCATTAAATGTTGACGAAAAGGTCTGGAAGAAGA
TAATGGGTCAAATGGAAGAGGAGAATTCTCAGGACGAGGAAGAAGACTGGGATGAAGAAG
AGGAAAGTGATGATGGGGAAGTTGAATACGTTGCAGATGATGGCGAAGGTGAATACGTTG
ACGTGGATGACTTAGAAAAGTGGTTAGCTGACTCTGACAGAGAAGCTTCCAGCGCCAGTG
AAAGCGAAAGCGACAGTGAAAGCGAGAGCGACAGCGATAGTGATGAAGAAAATAAGAATT
CAGCCAAGAGACGTAAGAAGGGAACTAGTGCCAAAACTAAACGTCCTAAAGTCGAAATCG
AATACGAGGAGGAACACGAAGTTCAAAATGCTGAGCAAGAAGTGGCACAATAAGCTCACG
CACTATACTACGCAACATTACATGATTTCAGTTTCTATTATTGAATGAACAGGATTTTTC
CACGTGGATTGGGCAGCGCACTGTACCATAATAACAACCAGTTATAAAATATTTCAATTC
TTTTACATATATAAAAATACATAAAGACTATTATTTTTGTAAGATGGCCCATTCTGTAAC
ACTTAAATTTCTTATCAAAAAAAAAAAAAATAATACCTTTAGTAGCTGTTGGGCTAATAA
CATTGCAAATTAGAAGCTTACTATTAGAAGCTTACTATTACGGGATTATTGAGGTAAAGG
TTATTTGAAGCGTAAATCACTGAAATCTTCCTGATCACGTGATTGGCTTTTTTTGCCAGA
AAACCCAAATCTGTTTAATGCCACTAAGTTGAAGAAACATATAATCAACAATTGTTGGCA
ATTCTAAGGGGAATAGTGCAACAAGAAGCCAGTAACGCCAAATAGAGGTTAGCGCCAAGC
AATAATTTACTGGTAGGTTCTTTCATTCCCTGATTTTACC
Chr coordinates Chr I from 99697-95630
w3c xhtml validator w3c css validator