Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CLN3
Systematic Name YAL040C
Alias DAF1, FUN10, WHI1
Strain S288c
Description G1 cyclin involved in cell cycle progression; activates Cdc28p kinase to promote the G1 to S phase transition; plays a role in regulating transcription of the other G1 cyclins, CLN1 and CLN2; regulated by phosphorylation and proteolysis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CLN3 YAL040C
CTGACAGAGACACCCGTAGAGGCTACATTACTGATTTGGGAAATTTCCCAAATTGGAAAT
ATCACCTCGTCGACGTGCTGCGGTGCATGGCTGTTTTACCCGTTTAGGAAAAAACTCGGC
GGGTTTTCTTGACGGGCAAATGTCGCCATTCGTCTCGTTTGAACGCTTGGCCTGTAAAAC
AGCTAACTCATTCACTATCTCTATCCTGCGACCGTGATGATACCGAAAGTATGCTGATAC
AGATCGGTCCCTCATATCGCGATAGGGCTTTCTGAGCTCTCCTCCCCCTTCTTCCCTCCC
CAGCCAAAGAGGCCGGTTTTCCTTCTGGGGAAGTGTCGCAACCAAACGCTGTGCTCAAAC
CCTAAATTGTGAACTTTCAAGAAAAAAAAAAAGAAAAAGTGAAAAATTATCAGGCAAGAA
AAAGAAATTACCAAGCCTGCTCTCACTGTAATGATCAAGTTACATAAATTTACTATCGGA
TTAGTGTGTCCCTCTGCCACATTTCCATATTTGGCCTTGGGTTTTTGCCCTCATCTTTTT
TTTTTCTTCCTCCTACCTATTTATAATTTGTATATCTGTACTTTCCTCGAGCTTTTAATC
TTCTTCTTAAACATTTTCTTGTGTAGTATACTTTCACACAATTTCTTTCTTGATTTTTTC
TTCTACTACTGAGTCTGCCAGTCAAATGGATTTCTGAGGAAAGAGGACTATACCCATTAG
GAAACGAATTGCCCGAGTAGTCTCCTCTGCCGACTTAAACCAACCTTTTTCTATTTCTCT
TTTCTTTTCTCCCTCTTTTTTCTCTGTACTAGCATCCAAAAGCAAGCATCCATCCGAGTC
CCAGTCGCAATCTCACATCTCCAATTTAACGTATCCATTGCATTTCCTCATTCGGTTTAA
CTCCTCTGCATTTCTTTTCTGACCCATAGCATTTCTTACATTCCATTGCATCTCCCTTTT
ACTCTCGTTCAAGACACTGATTTGATACGCTTTCTGTACG
Chr coordinates Chr I from 67520-65778
w3c xhtml validator w3c css validator