Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FLO9
Systematic Name YAL063C
Strain S288c
Description Lectin-like protein with similarity to Flo1p, thought to be expressed and involved in flocculation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FLO9 YAL063C
CGTCAGTGTCCGCAACAAAAAGTGGCTGTGAAATTAGGTATCTCTTGTTTACTTTCGAGA
TCAGAGGTCACATAGGGCACTCAAAAGGGTAGTCAGCTCACTTTAGTATTTAAGATACAC
CGACGCCATGTAAGAGGCAGGAACCGAAAAAAATATACAGCACCTGCCTGCTCCTTTTTC
AGGGAATACCGTGCGATGTCAAATTTTTTGCTGCTTTGTAAGCTAACCTTAATTTTAGTC
GGCTGACAAAATTCACTTTCCTATGGCTATTTCTGTGTTTTTTTTGTATCGCGCTTACTA
GGTGAAAACTTTATTTGACATTAAAGTTACATGCGTTTTTCTTCTTCCGGCCCAAAAAAT
GCAACTATAGTGTTCTAGAATTTTTTAGTCGTGCACCAAAATTATGCATTGAGAAAGCAC
TAAAAAGGACGGAGTAGTGATTTTTTCAATGTCTCTATCAATTTTCGGATCTGTCGCTAA
AACTAGTTTAAGTTTCTGGCGACCCTCCTGGAATGCTTACCTTGAGCGATGGGTACTTTC
CTTCATAGGTTATTCAACATTGCACGATATACAGAAAATATATTCTCTGTAAGGATATCG
TACCACATTTCAGAGCGCATTAATGCATGTAAAGGAAAGGTACATCACACACGACCACAG
ATTTTTTAAAAACTTTTCTTTTTCTTCTTTGTTCCTGACAATTCAGATGGCATAAAGAAA
ACGTTCGCAGTCAGATCAATTAGAAAGCATAACTCAAAATCTATCGGGTGGTATAACACA
GAAATTTAAGCAGCTAAAAAATTTTTTCTCTTTTAAAGGTATTCGATTTCCTCCTTTGCT
AACACATTATCCTGCCAAATTATTCTACCTTCTTATATATTACATAAAATTCGATGACAC
TAAAAGTCCATTAATAACATAACGTTCTTCCTTCTTATTTACAGGTACGCTCTTTAAATT
GCAATTTAAAAAGAACAATTGTACAATAAAAGCCCCAAAA
Chr coordinates Chr I from 27968-24000
w3c xhtml validator w3c css validator