Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FLO9
Systematic Name YAL063C
Strain S288c
Description Lectin-like protein with similarity to Flo1p, thought to be expressed and involved in flocculation
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>FLO9 YAL063C
ATGTCTCTGGCACATTATTGTTTACTACTAGCCATCGTCACATTGCTGGGATTAACTAAT
GTTGTCTCTGCGACTACAGCGGCATGCCTGCCAGCAAACTCAAGGAAGAATGGTATGAAT
GTAAACTTTTACCAGTATTCATTGAGAGATTCCTCCACATATTCGAATGCAGCATATATG
GCTTATGGATATGCCTCAAAAACTAAACTGGGTTCTGTCGGAGGACAAACTGATATCTCG
ATTGATTATAATATTCCTTGTGTTAGTTCATCAGGCACATTTCCTTGTCCTCAAGAAGAT
TTATATGGTAATTGGGGATGCAAAGGAATTGGTGCTTGTTCTAATAATCCAATAATTGCA
TACTGGAGTACTGATTTATTTGGTTTCTATACTACCCCAACAAACGTAACCCTAGAAATG
ACAGGTTATTTTTTACCACCACAGACGGGTTCTTACACATTCAAGTTTGCTACAGTTGAC
GACTCTGCAATTCTATCAGTCGGTGGTAGCATTGCGTTCGAATGTTGTGCACAAGAACAA
CCTCCCATCACGTCGACTAACTTCACCATCAATGGTATCAAGCCATGGAATGGAAGTCCC
CCTGATAATATTACAGGGACTGTCTACATGTATGCTGGTTTCTATTATCCAATGAAGATT
GTTTACTCAAATGCCGTTGCCTGGGGTACACTTCCAATTAGTGTGACACTACCAGATGGC
ACTACCGTTAGTGATGACTTTGAAGGGTACGTATATACTTTTGACAACAATCTAAGCCAG
CCAAACTGTACCATTCCAGACCCTTCAAATTATACTGTCAGTACTACCATAACTACAACG
GAACCATGGACCGGTACTTTCACTTCTACATCTACTGAAATGACCACCGTCACCGGTACC
AACGGCGTTCCAACTGACGAAACCGTCATTGTCATCAGAACTCCAACAACTGCTAGCACC
ATCATAACTACAACTGAGCCATGGAACAGCACTTTTACCTCTACTTCTACCGAATTGACC
ACAGTCACTGGCACCAATGGTGTACGAACTGACGAAACCATCATTGTAATCAGAACACCA
ACAACAGCCACTACTGCCATAACTACAACTGAGCCATGGAACAGCACTTTTACCTCTACT
TCTACCGAATTGACCACAGTCACCGGTACCAATGGTTTGCCAACTGATGAGACCATCATT
GTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGAC
ACTTTTACCTCTACTTCTACCGAATTGACCACAGTCACCGGTACCAATGGTTTGCCAACT
GATGAGACCATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACT
CAGCCATGGAACGACACTTTTACCTCTACTTCTACCGAATTGACCACAGTCACCGGTACC
AATGGTTTGCCAACTGATGAGACCATCATTGTCATCAGAACACCAACAACAGCCACTACT
GCCATGACTACAACTCAGCCATGGAACGACACTTTTACCTCTACATCCACTGAAATCACC
ACCGTCACCGGTACCAATGGTTTGCCAACTGATGAGACCATCATTGTCATCAGAACACCA
ACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGACACTTTTACCTCTACA
TCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCATT
GTCATCAGAACACCAACAACAGCCACTACTGCCATAACTACAACTGAGCCATGGAACAGC
ACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACT
GATGAAACCATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATAACTACAACT
CAGCCATGGAACGACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACC
AACGGTTTGCCAACTGATGAAACCATCATTGTCATCAGAACACCAACAACAGCCACTACT
GCCATGACTACAACTCAGCCATGGAACGACACTTTTACCTCTACATCCACTGAAATCACC
ACCGTCACCGGTACCAACGGTTTGCCAACTGATGAGACCATCATTGTCATCAGAACACCA
ACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGACACTTTTACCTCTACA
TCCACTGAAATGACCACCGTCACCGGTACCAACGGCGTTCCAACTGACGAAACCGTCATT
GTCATCAGAACTCCAACTAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGGT
ACTTTCACCTCTACATCCACTGAGATGACCACCGTCACCGGTACTAACGGTCAACCAACT
GACGAAACCGTGATTGTTATCAGAACTCCAACCAGTGAAGGTTTGGTTACAACTACAACC
GAGCCATGGACCGGTACTTTCACCTCTACATCTACTGAGATGACCACCATCACTGGAACC
AACGGTCAACCAACTGATGAAACTGTCATTATTGTCAAAACTCCAACTACTGCCATCTCA
TCCAGTTTGTCATCTTCTTCAGGACAAATCACCAGCTTTATCACGTCTGCGCGTCCAATT
ATTACCCCATTCTATCCTAGCAATGGAACTTCTGTGATTTCCTCCTCAGTAATTTCTTCC
TCAGACACTTCTTCTCTAGTCATTTCTTCCTCAGTCACTTCTTCTCTAGTCACTTCTTCT
CCAGTCATTTCTTCTTCATTCATTTCTTCCCCTGTCATTTCTTCTACAACAACCTCCGCT
TCTATACTCTCTGAATCATCTAAATCATCCGTCATTCCAACCAGTAGTTCCACCTCTGGT
TCTTCTGAGAGCGAAACGGGTTCAGCTAGTTCTGCCTCTTCTTCCTCTTCTATCTCTTCT
GAATCACCAAAGTCTACATATTCGTCTTCATCATTACCACCTGTTACCAGTGCAACAACA
AGTCAGGAAATTACTTCTTCATTACCACCTGTTACCACTACAAAAACGAGCGAACAAACC
ACTTTGGTTACCGTGACATCCTGCGAATCTCATGTGTGCACTGAATCTATCTCCTCTGCG
ATTGTTTCCACGGCCACCGTTACTGTTAGCGGTGCCACAACAGAGTATACCACATGGTGC
CCTATTTCTACCACAGAGATAACAAAGCAAACTACGGAGACAACAAAGCAAACCAAGGGG
ACAACAGAGCAAACCACAGAAACAACAAAACAAACCACAGTAGTTACAATTTCTTCTTGT
GAATCTGACGTATGCTCTAAGACTGCTTCTCCAGCCATTGTATCTACAAGCACTGCTACT
ATTAATGGCGTTACCACAGAATACACAACATGGTGTCCTATTTCCACCACAGAATCGAAG
CAACAAACTACGCTAGTTACTGTTACTTCCTGCGGATCTGGTGTGTGTTCCGAAACTACT
TCACCTGCCATTGTTTCGACGGCCACGGCTACTGTGAATGATGTTGTTACGGTCTATTCT
ACATGGAGGCCACAGACTACGAATGAACAGTCTGTCAGCTCTAAAATGAACAGTGCTACC
AGTGAGACAACAACCAATACTGGAGCTGCTGAGACAACTACCAGTACTGGAGCTGCTGAG
ACGAAAACAGTAGTCACCTCTTCAATTTCAAGATTCAATCATGCTGAAACACAGACGGCT
TCCGCGACCGATGTGATTGGTCACAGCAGTAGTGTTGTTTCTGTATCCGAAACTGGCAAC
ACCAAGAGTCTAACAAGTTCCGGGTTGAGTACTATGTCGCAACAGCCTCGTAGCACACCA
GCAAGTAGCATGGTAGGATCTAGTACAGCTTCTTTAGAAATTTCAACGTATGCTGGCAGT
GCCAACAGCTTACTGGCCGGTAGTGGTTTAAGTGTCTTCATTGCGTCCTTATTGCTGGCA
ATTATTTAA
Promoter Sequence
Download FASTA
>FLO9 YAL063C
CGTCAGTGTCCGCAACAAAAAGTGGCTGTGAAATTAGGTATCTCTTGTTTACTTTCGAGA
TCAGAGGTCACATAGGGCACTCAAAAGGGTAGTCAGCTCACTTTAGTATTTAAGATACAC
CGACGCCATGTAAGAGGCAGGAACCGAAAAAAATATACAGCACCTGCCTGCTCCTTTTTC
AGGGAATACCGTGCGATGTCAAATTTTTTGCTGCTTTGTAAGCTAACCTTAATTTTAGTC
GGCTGACAAAATTCACTTTCCTATGGCTATTTCTGTGTTTTTTTTGTATCGCGCTTACTA
GGTGAAAACTTTATTTGACATTAAAGTTACATGCGTTTTTCTTCTTCCGGCCCAAAAAAT
GCAACTATAGTGTTCTAGAATTTTTTAGTCGTGCACCAAAATTATGCATTGAGAAAGCAC
TAAAAAGGACGGAGTAGTGATTTTTTCAATGTCTCTATCAATTTTCGGATCTGTCGCTAA
AACTAGTTTAAGTTTCTGGCGACCCTCCTGGAATGCTTACCTTGAGCGATGGGTACTTTC
CTTCATAGGTTATTCAACATTGCACGATATACAGAAAATATATTCTCTGTAAGGATATCG
TACCACATTTCAGAGCGCATTAATGCATGTAAAGGAAAGGTACATCACACACGACCACAG
ATTTTTTAAAAACTTTTCTTTTTCTTCTTTGTTCCTGACAATTCAGATGGCATAAAGAAA
ACGTTCGCAGTCAGATCAATTAGAAAGCATAACTCAAAATCTATCGGGTGGTATAACACA
GAAATTTAAGCAGCTAAAAAATTTTTTCTCTTTTAAAGGTATTCGATTTCCTCCTTTGCT
AACACATTATCCTGCCAAATTATTCTACCTTCTTATATATTACATAAAATTCGATGACAC
TAAAAGTCCATTAATAACATAACGTTCTTCCTTCTTATTTACAGGTACGCTCTTTAAATT
GCAATTTAAAAAGAACAATTGTACAATAAAAGCCCCAAAA
Chr coordinates Chr I from 27968-24000
w3c xhtml validator w3c css validator