Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YAL064W-B
Systematic Name YAL064W-B
Strain S288c
Description Fungal-specific protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YAL064W-B YAL064W-B
TAACATAAAGTCACTGAGATATTAGAGGTTATAAAAAAAGACTACGTGGGTGTTTACCTA
AGATTTTCACAACTTGTTTATTAATTGGATAAATAGTATTTTTCTTGGCATTTACAAACT
TTATGTTTTTAGGTGTATTTGCAGTTCCATTAAGGGAAATAAGTCATAAGCTTTTTTGGA
AAACAGATTTTTTGCCCCGCTTAACCTGAAATTGATATTAAAAGAATGTGTGAATGGCCA
TTAACTAACAAGAGAATTAATAATGTTAAAACACAGATACCTCGAAACAAACTCTATGTA
AACACTTATTTTATTGTGGTAATATTTTTTGATAACAACACATCTGAAACAAAATAATGC
AAAGCCGAATAGTTAGGCTAAAAATGTACTCTTAGACATTTAAAAAGGTTTATGAATCCT
ATGGTATTTAATATATTAAAGAACGAAGTAAATGGGAAAAAATGTGTAAACACTATAAGC
GTGATGATAGAATTATTAATATAAGATGATGCCGTGCGTTTACCATACGATTGCCAGCAA
TACGGTGGAAATAAAAACACTTATGCCATTATTGGTCAACAGACCATTGGCAATACCAAC
GTAGGTTGAGATTTCTAAAGAGGCAGTACTAGATCCTATTATGCTACTTGCTGGTGTGCT
ACGAGGCTGTTGCGACATAGTACTTAACCCGGAAGTTATTAGACTCTTGGTGTTGCCAGT
TTCGGATACAGAAACAACACTACTGCTGTGACCAATCACATCGGTCGCGGAAGCCGTCTG
TGTTTCAGCATGATTGAATCTTGAAATTGAAGAGGTGACTACTGTTTTCGTCTCAGCAGC
TCCAGTACTGGTAGTTGTCTCAGCAGCTCCAGTATTGGTTGTTGTCTCACTGGTAGCACT
GTTCATTTTAGAGCTGACAGACTCTTCATTCGTAGTCTGTGGCCTCCATGTTGGATAGAC
CGTAACAACATCATTCACAGTAGCCGTGGCCGTCGAAACA
Chr coordinates Chr I from 12046-12426
w3c xhtml validator w3c css validator