Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SEO1
Systematic Name YAL067C
Strain S288c
Description Putative permease, member of the allantoate transporter subfamily of the major facilitator superfamily; mutation confers resistance to ethionine sulfoxide
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SEO1 YAL067C
TATATCCGATTCATTCTTCTTTGCAGCCAAGATGCAAAGTATATCGCTAAATTTTACCAT
GAGCGCAACAGCTGTATATTAATACGCTATTTGCTAATATATCGAACATAAAAATGTTTT
AATTACGTTAAAATATGTAAATCCTCTGAGCTTTGATAGCAAATTCTCAGATACTGTCAA
TTTCTTATCTGAAAAACCATTTGGTTTGACGTTCCTTTCATAACTAAACCAATTACAAAA
AGTGCAGAAATGTCATGGATACCATTGGCCTTAGATTTTTTAGAAGAGACTGGTAACCGC
GAGTAGAGCAACCAACTCACAATGCATAACTAAGATACAAACTTTATCTATAATATCGAA
TAGCTTGGTGAGATATTCATCTCATTCAATTCTAATTGGTCAAATATCTACAATGCCGTC
TGCTTTATGTCTTTTTCTAAAGGCATCGATTTTATGTGTGGATAATTGCATCGCAGTAAT
ATGTAGAGCACAATTTGTAGAAATCGGAATTGGAGGTATCGGATCTTGTTGAATATCCAC
CAATGTCTTACCCCTGTATTTTAACAAGAGTTTACGCTGTTATATGGTTAAAGGTGTGGA
CGCCTTGAAGGTTTACCTTACCGAATGACACCTTTACAATAGTCAGATCACGTTCTGTGG
CGTTATCCAAAGTTAGCGCAGTTTTCCGATGGTCCAATGTAATCATTAGAAATAGTAAAA
ACTGTGTAATGGTAAAGATTGTGTCACTGGAAAAAAACTGCTACAAATAATAAATAAATA
AAAAAATACGAAAGCACAGTACTACGGGTGCCTCCACAAATAGATAAGAAACCAAGCGGA
GACATGCGTTTAGATGAGGATATAAATTATTTATACAACCAGACTATATAAAAGAGCATC
TAGTTTACCTGTTATGATGAATGGACATTCGCTACATATCTTACTCTCTATTTGTTAAAA
AAAATTACAAAGAGAACTACTGCATATATAAATAACATAC
Chr coordinates Chr I from 9016-7235
w3c xhtml validator w3c css validator