Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RFA1
Systematic Name YAR007C
Alias BUF2, FUN3, RPA1, RPA70
Strain S288c
Description Subunit of heterotrimeric Replication Protein A (RPA), which is a highly conserved single-stranded DNA binding protein involved in DNA replication, repair, and recombination
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RFA1 YAR007C
TGAATGGAAACGAAGAGGATCACCAGGGTATGCTATAAACTTCCCACCAAAACGTCCACC
TGGGGACAAAACGTACCCTTGATCTCTCAATGCCTTGTATAAGAAATAGGTCTGCATTTT
TCCTGCCTGTCTGTACTGCTTAAATAACAAATCACTGATATCATCGCGGGATAAGCTGTC
TGAATCACTCCGTATGTCTCTTAAAATCATAGAGGTATTAGCAATGTCAATGAACAAAGA
AGATTCAATTAGCTGGTCATTATTGCTAGATTTATCAAGCCGTTGCAATTCTTCAGCTGT
GGTTTTATCATTGATTCTACCGATTTTCTTTAATTTTGCAATGTGTTCATCCTTTTTGAA
CTTTCTCTGATATTCAAATGACTTGTTCAAACGATCGTTGACAATTTTAGATAGTTTGGC
GCCCCGCTCTAATGTTATTCCCTCCATAATCTCATCTCCCTCTTGTCTTATTAATTTCAC
ATCGGCAAGATTGTTCAAATGCAGCCACAGCACATCTTCTAACATAAGCCTCAAAGGTAC
CGACAAAAATACATTTTGCTGTGCTGCAGTAGGCAAAGTTCCAGATAACACACCACAAAT
ACCCCATTTCCTTAGAAGTTTGATGTGATCTATGTCAAATACTAGCGGTGGCATAAAAAC
CTCCTCGCCTTTTGCCGTTCTTTTTGCATATATGTTAATAGCTATGCGCGTACCACCTTC
TTCAGCCATATACGAAAGGATCTATGCTAATTGGGTGGATTTCTTATCGCATCACTTTCT
TATTCTCTAACTCTTCTTCGCTGCTCAATAAAATATCTCTGCTTGGAAAAATGTCACGCG
TAAAAATTAGACGAGGCGACAAAAGACGCGTGAACTAACATAAAGGTTTACTTGAACAAA
TGTTATCACTTTAAGTTCTACACGTAAAACAAAAACTATTCACTCTTCTTATTACGGTAA
AGGCGAAACCAGCAAGAAGACCAGATTATACTTACAAGAG
Chr coordinates Chr I from 158619-156754
w3c xhtml validator w3c css validator