Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YAR010C
Systematic Name YAR010C
Alias YARCTyA1-1
Strain S288c
Description Retrotransposon TYA Gag gene co-transcribed with TYB Pol; in YARCTY1-1 TYB is mutant and probably non-functional
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YAR010C YAR010C
TGTCTAATACCAATATGTCCGATCCGGCTTCGAAGCCCAATTCTTTGGTTCAACATCTCT
ATGCTCCAGTTTTTGACAGAATGGATGTGTTGATGAAACAATTGGATGAAATTATTCGTA
AATGATATTGTCCTTACAATAAAGCCTGGTCTTTTTCTCATCCAACGAACTTGCATCATA
TTCATGAATATTTATTTGTTTTAGAAACATTTCGGAAAAAATAAGGTAGTAACAGTTCAG
CATATATGATAGCTAAAACAAACAACTATATATCGTATCTACAAAGTTTATCTTACTTCT
TCTATTTTTTAACTTTGCTTCAGATTATGATAATGAAAAGGAGGAATAAAATTCTGTCAT
TATTCAGCATCCTCCAATGTGTCATAGGGATATAACTGGGGTTGAGGAGGTAGTAGTCGA
CAACTACTTAGTCGTGATACAACAGTATGGATAGGTACTTTCCACGAACATTACTGATGA
CAGTCAGCTATTCACGAATTCAATTGTGTTGGATTAACAAAAAAATTTGGACGCAACCGG
AATCGAACCGATGACCTCTTCCTTGCAAGGGAAGCGCGCTACCAACTGCGCCATGTGCCC
AACTCATTACAATACTAGACTTATGAAGGAATGGTAAGTGCTTAGAAGCTTTATGATGTA
GTAGAGATTTAAGGCCATCAATTACATTGTTGAAAATAAGAACCTGTTGGAATAGAAATC
AACTATCATCTACTAACTAGTATTTACATTACTAGTATATTATCATATACGGTGTTAGAA
GATGACGCAAATGATGAGAAATAGTCATCTAAATTAGTGGAAGCTGAAACGCAAGGATTG
ATAATGTAATAGGATCAATGAATATAAACATATAAAACGGAATGAGGAATAATCGTAATA
TTAGTATGTAGAAATATAGATTCCATTTTGAGGATTCCTATATCCTCGAGGAGAACTTCT
AGTATATTCTGTATACCTAATATTATAGCCTTTATCAACA
Chr coordinates Chr I from 165866-164544
w3c xhtml validator w3c css validator