Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YAR023C
Systematic Name YAR023C
Strain S288c
Description Putative integral membrane protein, member of DUP240 gene family
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YAR023C YAR023C
GCGTGAATAGTTTTATTAACAAATATAAAGTTAGCAATCGGCCAGTAAAAGTTTTAACGC
AGGGACATCTCAGTAAATAAGTCATGCCTATGGTCCTCATCTAAATTTCGAAAAGAGACT
GTGTTACGTATTATTCGCGAAGAACAATGATGATATATATCTGGCGATTTTACGGCCATT
ATCAGCGGTAAAACACCCAAGGTGTTGACTAAGTGATGGAGTCTGCGGTGGACAAGTGTT
ACTTTTGCTATACTACTAATCCAGCATTCCGTGATCATAGTTTAAATGCGCTGGCGTATT
GGGAGCTCTTTGATACAACGAGAAGTCAGACATCAGCTCGCCGAAGCGTCCTAACAGTAA
CTAACTAACAATAAGCCTTAATGTAGTCCTCTTCCATATTCAATCTACTCTATATTCCGC
TGGAGACCTGCTCACTCAATAGATCAGAAACACTCTTATATCCAAAAATACACAGGTACG
AAAAATCTCGATCGAGAAATTCAAGGAAATAGAATAATCCTACACACATAACATTAAAAA
AAAAATCCCTACGACAGAACTTCCCAGTCTGCTTTTGATTTACTTTTAATAAATACAGAT
GTTTTTTCAGTACCTTTCATGTTCCCATCCTTGTTACGATATATACTTTCATCTGGGGGC
GCTAAAGAAAGCGAAAAGCTATGTACGTACAGTTGAAAAAAAGGAAAATACCAATTGAGG
TTTGAAATGTTCGACACATTCAAGTCTATTTTTCCTAAGCTATCAGGATAAGGTTTACTT
GACTTGTAAGCAAAAGCAAGTTAAATCGTTTGTTAAACATGCAATCTTATTTAAAAAAAA
CACTCATGTCACGGACGATCCTAAAGCAATCCCATTGAGGGAAGGATCTCCTGACAACCC
TGAAAGTCCTTTAATCTCAGCTGATATCGTCCTTCCAGAGGATGAGTTTGCATCATACCA
GAGTTATTTGCTTTACGAAATTGTACGCGCCAAGTATATA
Chr coordinates Chr I from 179820-179281
w3c xhtml validator w3c css validator