Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YAR028W
Systematic Name YAR028W
Strain S288c
Description Putative integral membrane protein; member of DUP240 gene family; GFP-fusion protein is induced in response to the DNA-damaging agent MMS
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YAR028W YAR028W
ACTTAATGAAATCGCTCGTTGTAAACCGCTAATGATTATGTTCCTAATACCTGTGTGTTT
GGTTTTATTGATTACGTTTTTTCATGATATCAAAGGTATCCTTGTGTTTTTAGTGATTTC
TCTTATCCTCTCTATTATCATTTTATTGATCGGTATAACTGCCTTCGTGTCTGAGACCTT
GAATAAGGGTTTCATAATTAAGCTTTTAGTAGAAGTCATTACACGTAAACCAGCAGTAGG
GGGGAAGGAATGGAGAATAATCGCATATAATATGAACCAGTATCTGTTTGACCATGGGAT
ATGGCATACTCCGTATTACTTTTTTTGTGAACATAGGTGCCATAAATTTTTCAAAAGCCT
TATCAAACAGACAAGGTCGAATGCACATTTGAGTTCACCAACGAACGGTGCAGAGAATAC
GCAGTCAAACACACCAGCAAAAGAGGTTTCAAATGAGATGGTAAAACCTTATATCTTTAG
TTCTGATCCAGTTTTAGAAGCTTACCTTATTAAAGCTGCGGAAATTCACAAAGAAGCTGA
ATTTGAGTATTGGAGAAAGCAATACCCAGAGGTTGATTTGCCTTAGGGCCGAATTTTTGG
TATTTATCTAGTATATTCTAATATAAAATGTACGAGCATCATTAACTTCAAGAACATTAC
GAAGCCCGCAATTAAGTGTCAGTCCATCTGGGTGTAAAAGTTATGTACGCTCGAAACAAA
TTTTATGTAGTTTACTTTAGATGCAAATGCTATTATATATTTTGCTTTATGATCCTCGGC
TTGATGCTCGCCAACGTGAGATAGCTGGTCATCACAATAGATCAGCCGGGACGCTTTTCG
ATCACATCGAATCCCTTCGGGACGTTGCAACAATACGTGAAAAATGCCTCAAAAATAATA
AATACAATGGTGAACAACGTTAAAAAAGCATAAAACAGCTGGCTATTTTGATCAGGATAA
CATCTATAAGTGCCATATTAAGGCAAGATATCAATTGACC
Chr coordinates Chr I from 184892-185596
w3c xhtml validator w3c css validator